Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28857
Trapped Gene
Nsbp1 (ENSMUSG00000031245)
Vector Insertion
Chr X: 106206785 - 106208590
Public Clones not available
Private Clones OST17843 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000695581 (ChrX:106208591..106208698 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGCCTAAGGATCTCCAACG ChrX:106208619..106208638 59.83 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000695581 (ChrX:106208591..106208698 -)
Downstram Exon
ENSMUSE00000695577 (ChrX:106206761..106206784 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGCCTAAGGATCTCCAACG ChrX:106208619..106208638 59.83 55 CTCCTGGCTCACATCACCTG ChrX:106206739..106206758 61.86 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000695581 ChrX:106208591..106208698 CTGCCTAAGGATCTCCAACG ChrX:106208619..106208638 59.83 55

*** Putative Vector Insertion (Chr X: 106206785 - 106208590) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000695577 ChrX:106206761..106206784 CTCCTGGCTCACATCACCTG ChrX:106206739..106206758 61.86 60
downstream ENSMUSE00000207580 ChrX:106206196..106206225 AGACAGTCGGGCTGATCTTC ChrX:106206177..106206196 59.41 55
downstream ENSMUSE00000207582 ChrX:106205893..106205946 No primer for this exon
downstream ENSMUSE00000207583 ChrX:106203501..106203635 CCACGACATTTGTGGTCTTG ChrX:106203589..106203608 60 50
downstream ENSMUSE00000207581 ChrX:106199874..106201410 TCCTCTTTGCATTTCCCATC ChrX:106200961..106200980 60.01 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATTTAATCGCCTTGCAGCAC ChrX:106208522..106208542 60.24 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCCTGCCTAAGGATCTCCAA ChrX:106208619..106208639 59.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031245