Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2886
Trapped Gene
Ankrd28 (ENSMUSG00000014496)
Vector Insertion
Chr 14: 32592192 - 32643512
Public Clones (sanger) (sanger) AE0180 (sanger) (sanger) IST14948G9 (tigm) IST14793C6 (tigm)
Private Clones OST117613 (lexicon)
Severity of mutation (?) Insertion after 1% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000690150 (Chr14:32643513..32643601 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000690150 (Chr14:32643513..32643601 -)
Downstram Exon
ENSMUSE00000562259 (Chr14:32592108..32592191 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000690150 Chr14:32643513..32643601 No primer for this exon

*** Putative Vector Insertion (Chr 14: 32592192 - 32643512) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000562259 Chr14:32592108..32592191 No primer for this exon
downstream ENSMUSE00000349484 Chr14:32577440..32577518 No primer for this exon
downstream ENSMUSE00000397168 Chr14:32568919..32568989 No primer for this exon
downstream ENSMUSE00000350323 Chr14:32561829..32562029 No primer for this exon
downstream ENSMUSE00000398720 Chr14:32560099..32560186 No primer for this exon
downstream ENSMUSE00000383556 Chr14:32558407..32558549 No primer for this exon
downstream ENSMUSE00000121822 Chr14:32556409..32556621 No primer for this exon
downstream ENSMUSE00000121839 Chr14:32549946..32550024 No primer for this exon
downstream ENSMUSE00000121830 Chr14:32548158..32548272 No primer for this exon
downstream ENSMUSE00000350556 Chr14:32546870..32546952 No primer for this exon
downstream ENSMUSE00000476295 Chr14:32545215..32545278 No primer for this exon
downstream ENSMUSE00000121834 Chr14:32543071..32543139 No primer for this exon
downstream ENSMUSE00000121832 Chr14:32540821..32540961 No primer for this exon
downstream ENSMUSE00000121802 Chr14:32535032..32535143 No primer for this exon
downstream ENSMUSE00000480322 Chr14:32533292..32533318 No primer for this exon
downstream ENSMUSE00000121826 Chr14:32532527..32532601 No primer for this exon
downstream ENSMUSE00000121840 Chr14:32528420..32528621 No primer for this exon
downstream ENSMUSE00000121824 Chr14:32525115..32525202 No primer for this exon
downstream ENSMUSE00000121804 Chr14:32524245..32524362 No primer for this exon
downstream ENSMUSE00000121836 Chr14:32523938..32524157 No primer for this exon
downstream ENSMUSE00000121800 Chr14:32522104..32522191 No primer for this exon
downstream ENSMUSE00000121806 Chr14:32521936..32522019 No primer for this exon
downstream ENSMUSE00000121843 Chr14:32521189..32521334 No primer for this exon
downstream ENSMUSE00000121812 Chr14:32520390..32520472 No primer for this exon
downstream ENSMUSE00000121838 Chr14:32519976..32520058 No primer for this exon
downstream ENSMUSE00000360514 Chr14:32518451..32518542 No primer for this exon
downstream ENSMUSE00000649778 Chr14:32513201..32515492 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TAATAATCGCCTTGCAGCAC Chr14:32643444..32643464 58.94 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTTGATGTGGTCGTGACTGG Chr14:32643452..32643472 60.01 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TATGGCACTCACGGTCCTTC Chr14:32643555..32643575 61.07 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 ATATGGCACTCACGGTCCTT Chr14:32643556..32643576 59.43 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000014496