Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28863
Trapped Gene
Gcom1 (ENSMUSG00000041361)
Vector Insertion
Chr 9: 71353037 - 71362875
Public Clones not available
Private Clones OST17700 (lexicon)
Severity of mutation (?) Insertion after 93% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000501664 (Chr9:71362876..71362976 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AGAAATTGGAGTGGGGTGTG Chr9:71362889..71362908 59.82 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000501664 (Chr9:71362876..71362976 -)
Downstram Exon
ENSMUSE00000584035 (Chr9:71352154..71353036 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AGAAATTGGAGTGGGGTGTG Chr9:71362889..71362908 59.82 50 GACTCTCGTGTACGGGGTGT Chr9:71352951..71352970 60.03 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000584036 Chr9:71439997..71440167 ACGTCCACTGTCACCCTGTT Chr9:71440040..71440059 60.48 55
upstream ENSMUSE00000520753 Chr9:71427418..71427504 AGTGCCACAGCAAACAGAAA Chr9:71427441..71427460 59.49 45
upstream ENSMUSE00000316294 Chr9:71412217..71412372 AATGGTCGTGTATGGCTGGT Chr9:71412258..71412277 60.26 50
upstream ENSMUSE00000316277 Chr9:71408762..71408854 AGGAAGCGGATGTATGGAGA Chr9:71408811..71408830 59.65 50
upstream ENSMUSE00000316261 Chr9:71406655..71406768 CCATGCTCAGCAGGACTATCT Chr9:71406743..71406763 59.47 52.38
upstream ENSMUSE00000316247 Chr9:71403392..71403544 AAAACCCTTGTGGACGTGAC Chr9:71403525..71403544 59.87 50
upstream ENSMUSE00000316219 Chr9:71400046..71400171 GGGAGATGACGAGAAAGCTG Chr9:71400115..71400134 59.95 55
upstream ENSMUSE00000316203 Chr9:71397986..71398114 TGATTGAACGCATGGAGAAG Chr9:71397986..71398005 59.8 45
upstream ENSMUSE00000316188 Chr9:71396531..71396610 GCTCCTTGAGCATGAGACAG Chr9:71396568..71396587 58.7 55
upstream ENSMUSE00000316172 Chr9:71394476..71394581 CAGACACCTGGATGACATGG Chr9:71394517..71394536 59.95 55
upstream ENSMUSE00000499870 Chr9:71372589..71372672 No primer for this exon
upstream ENSMUSE00000501664 Chr9:71362876..71362976 AGAAATTGGAGTGGGGTGTG Chr9:71362889..71362908 59.82 50

*** Putative Vector Insertion (Chr 9: 71353037 - 71362875) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000584035 Chr9:71352154..71353036 GACTCTCGTGTACGGGGTGT Chr9:71352951..71352970 60.03 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGAAGGTAGCAGCTGTTTGG Chr9:71356834..71356854 59.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GGAAGGTAGCAGCTGTTTGG Chr9:71356834..71356854 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000041361