Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28868
Trapped Gene
Defb20 (ENSMUSG00000049560)
Vector Insertion
Chr 2: 152302908 - 152305089
Public Clones not available
Private Clones OST17601 (lexicon) OST15313 (lexicon) OST14681 (lexicon)
Severity of mutation (?) Insertion after 31% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000445613 (Chr2:152302799..152302907 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGTCTCGGGAGGATCTGAAG Chr2:152302837..152302856 60.34 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000445613 (Chr2:152302799..152302907 +)
Downstram Exon
ENSMUSE00000681757 (Chr2:152305090..152305461 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGTCTCGGGAGGATCTGAAG Chr2:152302837..152302856 60.34 55 CCGTGGGCAGGATCATATAG Chr2:152305308..152305327 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000445613 Chr2:152302799..152302907 TGTCTCGGGAGGATCTGAAG Chr2:152302837..152302856 60.34 55

*** Putative Vector Insertion (Chr 2: 152302908 - 152305089) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000352102 Chr2:152305090..152305670 TGAAACGCAAGCAATACAGC Chr2:152305525..152305544 60.02 45
downstream ENSMUSE00000681757 Chr2:152305090..152305461 CCGTGGGCAGGATCATATAG Chr2:152305308..152305327 60.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GACACAAGTGCTGGTGCTGT Chr2:152302940..152302960 59.95 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTGCAGGTAACGTGTCCAA Chr2:152302902..152302922 59.76 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049560