Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28873
Trapped Gene
Stk10 (ENSMUSG00000020272)
Vector Insertion
Chr 11: 32489492 - 32496614
Public Clones not available
Private Clones OST17494 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000361316 (Chr11:32489410..32489491 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000361316 (Chr11:32489410..32489491 +)
Downstram Exon
ENSMUSE00000346104 (Chr11:32496615..32496749 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662709 Chr11:32433266..32433559 No primer for this exon
upstream ENSMUSE00000252371 Chr11:32455124..32455288 No primer for this exon
upstream ENSMUSE00000252363 Chr11:32474499..32474547 No primer for this exon
upstream ENSMUSE00000102920 Chr11:32477624..32477773 No primer for this exon
upstream ENSMUSE00000102914 Chr11:32487313..32487385 No primer for this exon
upstream ENSMUSE00000102926 Chr11:32488756..32488950 No primer for this exon
upstream ENSMUSE00000361316 Chr11:32489410..32489491 No primer for this exon

*** Putative Vector Insertion (Chr 11: 32489492 - 32496614) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000346104 Chr11:32496615..32496749 No primer for this exon
downstream ENSMUSE00000252326 Chr11:32498439..32498984 No primer for this exon
downstream ENSMUSE00000662708 Chr11:32500741..32500871 No primer for this exon
downstream ENSMUSE00000662707 Chr11:32503667..32503790 No primer for this exon
downstream ENSMUSE00000351342 Chr11:32504121..32504300 No primer for this exon
downstream ENSMUSE00000384657 Chr11:32510633..32510725 No primer for this exon
downstream ENSMUSE00000333765 Chr11:32512671..32512800 No primer for this exon
downstream ENSMUSE00000361044 Chr11:32513462..32513586 No primer for this exon
downstream ENSMUSE00000345753 Chr11:32514525..32514713 No primer for this exon
downstream ENSMUSE00000338085 Chr11:32515781..32515906 No primer for this exon
downstream ENSMUSE00000580416 Chr11:32517849..32517962 No primer for this exon
downstream ENSMUSE00000430070 Chr11:32522424..32524593 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCAAGTTAATCGCCTTGC Chr11:32489535..32489555 59.71 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAGAGGATGGGTCTGTGAGG Chr11:32489443..32489463 60.67 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020272