Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28881
Trapped Gene
4930473A02Rik (ENSMUSG00000060029)
Vector Insertion
Chr 2: 130386660 - 130389389
Public Clones CMHD-GT_447C12-3 (cmhd)
Private Clones OST17328 (lexicon)
Severity of mutation (?) Insertion after 30% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000468887 (Chr2:130389390..130389426 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTTGCTGTCTGGTCCAATG Chr2:130389407..130389426 59.83 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000468887 (Chr2:130389390..130389426 -)
Downstram Exon
ENSMUSE00000467969 (Chr2:130386426..130386659 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTTGCTGTCTGGTCCAATG Chr2:130389407..130389426 59.83 50 GTGTAGAGAGCCCTGCGTTC Chr2:130386523..130386542 60.02 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000641115 Chr2:130389468..130389485 No primer for this exon
upstream ENSMUSE00000470703 Chr2:130389428..130389466 CTCCTGTCCTCGTCCCTGTT Chr2:130389436..130389455 61.63 60
upstream ENSMUSE00000468887 Chr2:130389390..130389426 TCTTGCTGTCTGGTCCAATG Chr2:130389407..130389426 59.83 50

*** Putative Vector Insertion (Chr 2: 130386660 - 130389389) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000467969 Chr2:130386426..130386659 GTGTAGAGAGCCCTGCGTTC Chr2:130386523..130386542 60.02 60
downstream ENSMUSE00000474794 Chr2:130383359..130383520 AAGCTCCATGGTGAGCAGAT Chr2:130383468..130383487 59.83 50
downstream ENSMUSE00000473917 Chr2:130378578..130378652 GCTTGGCTTTCCTGTTCAGA Chr2:130378565..130378584 60.52 50
downstream ENSMUSE00000473019 Chr2:130378089..130378171 GAGCTCCGCAGACTCAAAAG Chr2:130378119..130378138 60.28 55
downstream ENSMUSE00000472098 Chr2:130377875..130377978 AGGACGGACAGGAACCTTCT Chr2:130377920..130377939 60.11 55
downstream ENSMUSE00000463493 Chr2:130370672..130370801 ACTTCTGGCGAATGATCTGG Chr2:130370724..130370743 60.22 50
downstream ENSMUSE00000462591 Chr2:130370097..130370294 AGTCAAACGAGGCGAAGAGA Chr2:130370160..130370179 60.13 50
downstream ENSMUSE00000493246 Chr2:130369527..130369853 TTAGTGAGTGGCGGGAGTCT Chr2:130369716..130369735 59.87 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TCTTGCTGTCTGGTCCAATG Chr2:130389405..130389425 59.83 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCTTGCTGTCTGGTCCAATG Chr2:130389405..130389425 59.83 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000060029