Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28882
Trapped Gene
Ddx60 (ENSMUSG00000037921)
Vector Insertion
Chr 8: 64442539 - 64448249
Public Clones not available
Private Clones OST17267 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000636777 (Chr8:64442381..64442538 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000636777 (Chr8:64442381..64442538 +)
Downstram Exon
ENSMUSE00000607577 (Chr8:64448250..64448502 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon GCAAGCCTGTAACCCAACTC Chr8:64448471..64448490 59.74 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000582155 Chr8:64406886..64407073 TGGAGCTAGCGATTGGTCTT Chr8:64406927..64406946 59.98 50
upstream ENSMUSE00000449051 Chr8:64418796..64418903 TCCAGTTCAGGTTGAAAGCA Chr8:64418865..64418884 59.42 45
upstream ENSMUSE00000263512 Chr8:64419088..64419154 No primer for this exon
upstream ENSMUSE00000263505 Chr8:64419400..64419589 CTGATTGATGGCGACTCCTT Chr8:64419443..64419462 60.22 50
upstream ENSMUSE00000263501 Chr8:64421089..64421430 TGAACGACCTGCAGACACAT Chr8:64421273..64421292 60.32 50
upstream ENSMUSE00000263496 Chr8:64424649..64424765 AGCCTGATTCAACAGCTGGA Chr8:64424679..64424698 60.94 50
upstream ENSMUSE00000263490 Chr8:64427609..64427770 TGGCCAGAAGGATCTGACAT Chr8:64427642..64427661 60.62 50
upstream ENSMUSE00000636782 Chr8:64429224..64429382 CGCTCAAGATTCATCACTGC Chr8:64429326..64429345 59.55 50
upstream ENSMUSE00000636781 Chr8:64433295..64433436 AGTGATGAGCCTTTGTTGAGG Chr8:64433379..64433399 59.34 47.62
upstream ENSMUSE00000636780 Chr8:64434912..64435067 GATGTGGGAAAACCAATTCCT Chr8:64434995..64435015 60.05 42.86
upstream ENSMUSE00000636779 Chr8:64436842..64436947 AAGTTCCCAGGAGATGATGC Chr8:64436843..64436862 59.09 50
upstream ENSMUSE00000636778 Chr8:64437358..64437473 CCCCATTGTTACGTCACTGG Chr8:64437364..64437383 61.2 55
upstream ENSMUSE00000683373 Chr8:64437358..64437460 CCCCATTGTTACGTCACTGG Chr8:64437364..64437383 61.2 55
upstream ENSMUSE00000683371 Chr8:64441131..64441146 No primer for this exon
upstream ENSMUSE00000636777 Chr8:64442381..64442538 No primer for this exon

*** Putative Vector Insertion (Chr 8: 64442539 - 64448249) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000607577 Chr8:64448250..64448502 GCAAGCCTGTAACCCAACTC Chr8:64448471..64448490 59.74 55
downstream ENSMUSE00000607576 Chr8:64450952..64451118 CCAACAAGGAATGGATCCTC Chr8:64451017..64451036 59.34 50
downstream ENSMUSE00000263451 Chr8:64452832..64452990 GGGGTCTGGGTCTTTTCTTT Chr8:64452960..64452979 59.42 50
downstream ENSMUSE00000263446 Chr8:64454556..64454705 TTCATCGCTCTCTTTCAGCA Chr8:64454678..64454697 59.82 45
downstream ENSMUSE00000263443 Chr8:64456681..64456800 TGGCGATAATCCCTGGTAAA Chr8:64456784..64456803 60.28 45
downstream ENSMUSE00000263438 Chr8:64458054..64458149 TTTGGCGATGAGGAGCTAGT Chr8:64458114..64458133 59.98 50
downstream ENSMUSE00000263431 Chr8:64461279..64461394 ATGCTGAGGGTTGCTAATGG Chr8:64461389..64461408 60.1 50
downstream ENSMUSE00000263427 Chr8:64462598..64462740 CACGGGAGGTACCAGTTCTT Chr8:64462689..64462708 59.06 55
downstream ENSMUSE00000263423 Chr8:64462877..64462986 CCTGTCTCACGGAACACAAA Chr8:64462936..64462955 59.72 50
downstream ENSMUSE00000421132 Chr8:64466149..64466253 GTATGCTTTCTCGGGGTGAA Chr8:64466206..64466225 60.07 50
downstream ENSMUSE00000607575 Chr8:64466837..64466965 CCCAATTCGTGAATTCTTCC Chr8:64466945..64466964 59.36 45
downstream ENSMUSE00000607574 Chr8:64468607..64468731 AGTGCAGGCAACTTCTCCAT Chr8:64468725..64468744 59.87 50
downstream ENSMUSE00000607573 Chr8:64473173..64473331 TAGCCGTGGTACGAGCTTCT Chr8:64473288..64473307 60.04 55
downstream ENSMUSE00000607572 Chr8:64477429..64477576 ATGTGCAGTCCTTGGGAATC Chr8:64477550..64477569 59.93 50
downstream ENSMUSE00000448888 Chr8:64479348..64479500 GGTGAAACACCCTCTGCAAT Chr8:64479372..64479391 59.97 50
downstream ENSMUSE00000263341 Chr8:64488739..64488843 GATTCCCAAAGCGAGTGTTC Chr8:64488777..64488796 59.68 50
downstream ENSMUSE00000263336 Chr8:64491068..64491268 TGCCATCCTCTAGGTCATCC Chr8:64491263..64491282 60.03 55
downstream ENSMUSE00000263331 Chr8:64495938..64496042 CGGGGTTGTTTGAAGGATAA Chr8:64495987..64496006 59.79 45
downstream ENSMUSE00000263322 Chr8:64496539..64496680 AAGGCCAGCAAACCCTGTAG Chr8:64496586..64496605 61.54 55
downstream ENSMUSE00000263317 Chr8:64500085..64500206 GCCAATACCAAAACCAGCTT Chr8:64500139..64500158 59.09 45
downstream ENSMUSE00000263312 Chr8:64501947..64502094 ACTGAAGTCCTCGGGAAGGT Chr8:64501982..64502001 60.11 55
downstream ENSMUSE00000263305 Chr8:64503646..64503788 TGAGACACAAGTGGCGAATC Chr8:64503691..64503710 59.84 50
downstream ENSMUSE00000263299 Chr8:64512172..64512323 AATCCAATAAGGGATCCATGC Chr8:64512310..64512330 60 42.86
downstream ENSMUSE00000263291 Chr8:64513839..64513901 GGCTATAAGCTTCCCCTGGA Chr8:64513867..64513886 60.54 55
downstream ENSMUSE00000607571 Chr8:64515832..64516492 CACACAGTTCACGCAAGGAG Chr8:64515857..64515876 60.5 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTGCTATTTTAATCGCCTTGC Chr8:64442581..64442602 59.38 38.1 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCAAGAGCACAAAGGCACAT Chr8:64442520..64442540 61.24 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000037921