Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28888
Trapped Gene
Slc38a9 (ENSMUSG00000047789)
Vector Insertion
Chr 13: 113504456 - 113513405
Public Clones not available
Private Clones OST17140 (lexicon) OST17134 (lexicon)
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000342084 (Chr13:113504349..113504455 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGATGGGGGTGCTTACTCT Chr13:113504372..113504391 59.16 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000342084 (Chr13:113504349..113504455 +)
Downstram Exon
ENSMUSE00000353578 (Chr13:113513406..113513519 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGATGGGGGTGCTTACTCT Chr13:113504372..113504391 59.16 55 GTAATGGAGGCGAAGGGAAT Chr13:113513502..113513521 60.29 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000435670 Chr13:113450984..113451080 TTTCCGACGTAGAGGGATTG Chr13:113451051..113451070 60.07 50
upstream ENSMUSE00000354921 Chr13:113459795..113459939 TGGGCCTATGAACATCCAGT Chr13:113459892..113459911 60.34 50
upstream ENSMUSE00000365765 Chr13:113476274..113476406 CTCACCACTCCTGCAGACAA Chr13:113476380..113476399 60.02 55
upstream ENSMUSE00000408687 Chr13:113479481..113479602 CCATTGGGCTCTGCCTATAA Chr13:113479532..113479551 60.05 50
upstream ENSMUSE00000378819 Chr13:113479730..113479793 ATTCCTTGGGGCATAAAACA Chr13:113479773..113479792 59.27 40
upstream ENSMUSE00000338903 Chr13:113480367..113480460 TGGTGAAGTCACGGAGTACG Chr13:113480437..113480456 59.74 55
upstream ENSMUSE00000392484 Chr13:113485449..113485619 CTTTGGGCAATGGTCAAGTC Chr13:113485507..113485526 60.49 50
upstream ENSMUSE00000352033 Chr13:113488193..113488252 No primer for this exon
upstream ENSMUSE00000349625 Chr13:113491665..113491859 AAGTGGTGGGACAAGTCCAG Chr13:113491754..113491773 60 55
upstream ENSMUSE00000403016 Chr13:113493746..113493853 CTGAAGGCTGTTCGCTTAGG Chr13:113493784..113493803 60.15 55
upstream ENSMUSE00000342084 Chr13:113504349..113504455 CTGATGGGGGTGCTTACTCT Chr13:113504372..113504391 59.16 55

*** Putative Vector Insertion (Chr 13: 113504456 - 113513405) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000353578 Chr13:113513406..113513519 GTAATGGAGGCGAAGGGAAT Chr13:113513502..113513521 60.29 50
downstream ENSMUSE00000332822 Chr13:113516255..113516403 GTCACTGCTGGGGAAGTTGT Chr13:113516287..113516306 60.16 55
downstream ENSMUSE00000375637 Chr13:113519406..113519495 GTCACTCCAGCTCCCACAAT Chr13:113519459..113519478 60.12 55
downstream ENSMUSE00000467709 Chr13:113521707..113523106 GGGAATGAGGGTCACTGAGA Chr13:113522086..113522105 60.05 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGTGGCTAACTCGGAAGCTG Chr13:113504460..113504480 59.64 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTGGCTAACTCGGAAGCTG Chr13:113504460..113504480 59.64 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000047789