Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2889
Trapped Gene
Cog3 (ENSMUSG00000034893)
Vector Insertion
Chr 14: 76121999 - 76124517
Public Clones AE0170 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 69% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000275936 (Chr14:76124518..76124642 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CACAGACGACGATCTCTCCA Chr14:76124596..76124615 59.98 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000275936 (Chr14:76124518..76124642 -)
Downstram Exon
ENSMUSE00000276095 (Chr14:76121909..76121998 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CACAGACGACGATCTCTCCA Chr14:76124596..76124615 59.98 55 TGATGCTCCTAGCAAGGACTG Chr14:76121908..76121928 60.54 52.38

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000518663 Chr14:76154072..76154300 GCGAGAAGCTGTCTCTCTGG Chr14:76154171..76154190 60.43 60
upstream ENSMUSE00000276015 Chr14:76146860..76147006 ATGCAGCTTAGCATCCCAGT Chr14:76146970..76146989 59.87 50
upstream ENSMUSE00000276005 Chr14:76143373..76143434 TTGCAAAACTGCAAACTCAGA Chr14:76143401..76143421 59.64 38.1
upstream ENSMUSE00000275991 Chr14:76142148..76142313 CATCAGGAGTCGTTGCAGAA Chr14:76142218..76142237 59.98 50
upstream ENSMUSE00000276201 Chr14:76141488..76141562 TCTTGCTGAGCACATCCAAC Chr14:76141529..76141548 59.99 50
upstream ENSMUSE00000276194 Chr14:76140343..76140435 TTCCCCTACGTTGTCTGTGA Chr14:76140408..76140427 59.13 50
upstream ENSMUSE00000276185 Chr14:76139311..76139436 AGCTTTGCACCTCATGAAGAC Chr14:76139360..76139380 59.49 47.62
upstream ENSMUSE00000276170 Chr14:76137770..76137850 CCCTCATCAGTCCCTAATGC Chr14:76137828..76137847 59.51 55
upstream ENSMUSE00000275970 Chr14:76133705..76133748 No primer for this exon
upstream ENSMUSE00000276157 Chr14:76132718..76132844 GGCCCAAGTATTGCCTACAC Chr14:76132764..76132783 59.46 55
upstream ENSMUSE00000276148 Chr14:76131783..76131874 TATGGTCCATGTCTGCCAAG Chr14:76131835..76131854 59.52 50
upstream ENSMUSE00000276136 Chr14:76130402..76130541 AGAAATTGTGCGTGTCGTTG Chr14:76130511..76130530 59.76 45
upstream ENSMUSE00000276121 Chr14:76129078..76129238 CAGACGGACATCACAGGCTA Chr14:76129130..76129149 59.85 55
upstream ENSMUSE00000275948 Chr14:76127515..76127620 CGCCTTCAGAAGCTTCCTTT Chr14:76127564..76127583 61 50
upstream ENSMUSE00000275936 Chr14:76124518..76124642 CACAGACGACGATCTCTCCA Chr14:76124596..76124615 59.98 55

*** Putative Vector Insertion (Chr 14: 76121999 - 76124517) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000276095 Chr14:76121909..76121998 TGATGCTCCTAGCAAGGACTG Chr14:76121908..76121928 60.54 52.38
downstream ENSMUSE00000276089 Chr14:76119499..76119619 TTTCTTGAGGTCCAGGGAAA Chr14:76119484..76119503 59.64 45
downstream ENSMUSE00000276082 Chr14:76116916..76117004 TCAAGGCATTGTTGCTATTCA Chr14:76116911..76116931 59.31 38.1
downstream ENSMUSE00000276075 Chr14:76116675..76116809 GACTTCAGGTGCCGGTCTAC Chr14:76116723..76116742 59.73 60
downstream ENSMUSE00000275913 Chr14:76113008..76113083 GCTGTGAGAGGGTGTACTTGG Chr14:76113004..76113024 59.78 57.14
downstream ENSMUSE00000276062 Chr14:76107729..76107856 GCCATGCTTCTCAGTGTCAG Chr14:76107759..76107778 59.58 55
downstream ENSMUSE00000276051 Chr14:76106897..76106995 CCTTTAGCAGAGCGTGGAAC Chr14:76106928..76106947 60.01 55
downstream ENSMUSE00000379852 Chr14:76102158..76103867 TCCGATTCCAACTCAACCTC Chr14:76103355..76103374 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTAATCGCCTTGCAGCACAT Chr14:76124447..76124467 61.69 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TCGAAGGACACTTGTCTGTCTC Chr14:76124540..76124562 59.5 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034893