Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28910
Trapped Gene
Adssl1 (ENSMUSG00000011148)
Vector Insertion
Chr 12: 113877973 - 113879168
Public Clones not available
Private Clones OST16813 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000116513 (Chr12:113877823..113877972 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000116513 (Chr12:113877823..113877972 +)
Downstram Exon
ENSMUSE00000399287 (Chr12:113879169..113879550 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000307667 Chr12:113858256..113858521 No primer for this exon
upstream ENSMUSE00000116507 Chr12:113866512..113866614 No primer for this exon
upstream ENSMUSE00000116512 Chr12:113870465..113870527 No primer for this exon
upstream ENSMUSE00000116503 Chr12:113870906..113870956 No primer for this exon
upstream ENSMUSE00000681465 Chr12:113871211..113871346 No primer for this exon
upstream ENSMUSE00000608904 Chr12:113871280..113871346 No primer for this exon
upstream ENSMUSE00000116505 Chr12:113872355..113872462 No primer for this exon
upstream ENSMUSE00000307623 Chr12:113872591..113872672 No primer for this exon
upstream ENSMUSE00000307614 Chr12:113872812..113872938 No primer for this exon
upstream ENSMUSE00000116509 Chr12:113873642..113873796 No primer for this exon
upstream ENSMUSE00000116504 Chr12:113874605..113874729 No primer for this exon
upstream ENSMUSE00000116502 Chr12:113876396..113876493 No primer for this exon
upstream ENSMUSE00000116513 Chr12:113877823..113877972 No primer for this exon

*** Putative Vector Insertion (Chr 12: 113877973 - 113879168) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000399287 Chr12:113879169..113879550 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAATCACATGGGTGTTGCAG Chr12:113877954..113877974 59.97 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTTCGTGGAGAATCACATGG Chr12:113877945..113877965 59.09 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000011148