Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28925
Trapped Gene
Myh7b (ENSMUSG00000074652)
Vector Insertion
Chr 2: 155443662 - 155444469
Public Clones not available
Private Clones OST15920 (lexicon)
Severity of mutation (?) Insertion after 14% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000639685 (Chr2:155443598..155443661 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTCTGCGGACATTGATAGC Chr2:155443641..155443660 60.76 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000639685 (Chr2:155443598..155443661 +)
Downstram Exon
ENSMUSE00000639684 (Chr2:155444470..155444568 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTCTGCGGACATTGATAGC Chr2:155443641..155443660 60.76 55 GACATGGTAACCACGCTCAC Chr2:155444531..155444550 59.01 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000681109 Chr2:155436979..155436997 No primer for this exon
upstream ENSMUSE00000639693 Chr2:155437323..155437484 GGTCCTCCTTTTGCACCTCT Chr2:155437367..155437386 60.63 55
upstream ENSMUSE00000639692 Chr2:155438884..155438990 AGCAGGATGCCTATGTGGAG Chr2:155438911..155438930 60.24 55
upstream ENSMUSE00000639691 Chr2:155439169..155439312 CCCGTTTCGACTTACTGGAG Chr2:155439212..155439231 59.73 55
upstream ENSMUSE00000639690 Chr2:155439775..155439931 TACAAATGGCTCCCGGTCTA Chr2:155439811..155439830 60.46 50
upstream ENSMUSE00000639689 Chr2:155440204..155440231 CCGAGAGAATCAGTCCATGC Chr2:155440205..155440224 60.77 55
upstream ENSMUSE00000639688 Chr2:155441137..155441233 GTTAACACCAAGCGGGTCAT Chr2:155441162..155441181 59.86 50
upstream ENSMUSE00000639687 Chr2:155443260..155443283 TTTCTGGCGACAAAGACAGG Chr2:155443263..155443282 61.34 50
upstream ENSMUSE00000639686 Chr2:155443384..155443476 GCACCCTTGAGGATCAAATC Chr2:155443385..155443404 59.49 50
upstream ENSMUSE00000639685 Chr2:155443598..155443661 CCTCTGCGGACATTGATAGC Chr2:155443641..155443660 60.76 55

*** Putative Vector Insertion (Chr 2: 155443662 - 155444469) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000639684 Chr2:155444470..155444568 GACATGGTAACCACGCTCAC Chr2:155444531..155444550 59.01 55
downstream ENSMUSE00000639683 Chr2:155445826..155445929 CGTAGGGATTCATGGACAGG Chr2:155445858..155445877 60.33 55
downstream ENSMUSE00000639682 Chr2:155446123..155446261 GGAGAGCACCCACGATCTTA Chr2:155446195..155446214 60.22 55
downstream ENSMUSE00000639681 Chr2:155446517..155446635 ACTCATTTCCCACACGAACC Chr2:155446609..155446628 59.83 50
downstream ENSMUSE00000639680 Chr2:155446728..155446877 GAACTGTCGAGGGAGCTTTG Chr2:155446838..155446857 59.99 55
downstream ENSMUSE00000639679 Chr2:155447002..155447172 TGTGCTGGTTGAAGAACTGC Chr2:155447074..155447093 60.03 50
downstream ENSMUSE00000639678 Chr2:155447904..155448083 GAGCCTGGTACTTGCGTTTC Chr2:155448057..155448076 59.88 55
downstream ENSMUSE00000639677 Chr2:155448170..155448302 TCTCATTGAGGGGATCCTTG Chr2:155448227..155448246 60 50
downstream ENSMUSE00000639676 Chr2:155448381..155448457 CTGCTTTCTTGCGCTTCTCT Chr2:155448428..155448447 60.04 50
downstream ENSMUSE00000639675 Chr2:155448939..155449026 GACGATACAGCGGACGAAAT Chr2:155449007..155449026 60.1 50
downstream ENSMUSE00000639674 Chr2:155449180..155449297 ACAGCAGTCTGTTGGGGAAC Chr2:155449281..155449300 60.16 55
downstream ENSMUSE00000639673 Chr2:155451376..155451499 TTCTGCTGTCCACAAAGGTG Chr2:155451434..155451453 59.87 50
downstream ENSMUSE00000639672 Chr2:155451587..155451723 CCTAGCATGCGCTGGTACTC Chr2:155451720..155451739 60.96 60
downstream ENSMUSE00000639671 Chr2:155452073..155452328 GACCAGTTCTTGACGGCATT Chr2:155452135..155452154 60.12 50
downstream ENSMUSE00000639670 Chr2:155453308..155453550 CACCTTGGACTTGATCAGCA Chr2:155453370..155453389 59.83 50
downstream ENSMUSE00000639669 Chr2:155454229..155454405 CGCCATCTCTTCTGTCAGGT Chr2:155454258..155454277 60.41 55
downstream ENSMUSE00000639668 Chr2:155454490..155454635 TTGTGTCTGTCACCGTCTCC Chr2:155454601..155454620 59.71 55
downstream ENSMUSE00000639667 Chr2:155454855..155454945 TGACTCAGCTCCGAATCCTT Chr2:155454878..155454897 59.95 50
downstream ENSMUSE00000639666 Chr2:155455027..155455416 GCTCGCTCTTCTCCTTTTCC Chr2:155455363..155455382 60.6 55
downstream ENSMUSE00000639665 Chr2:155455994..155456120 GGTCCTCATAGGTCCGACAC Chr2:155456033..155456052 59.38 60
downstream ENSMUSE00000639664 Chr2:155456211..155456329 GCCGAAGTTCCTCCAGACTC Chr2:155456309..155456328 61.31 60
downstream ENSMUSE00000639663 Chr2:155456417..155456613 CTCTTCCTCGTGCTGCTCTC Chr2:155456497..155456516 60.43 60
downstream ENSMUSE00000639662 Chr2:155456747..155457096 TCTTGTTCTCCCGCTTGAGT Chr2:155457090..155457109 59.99 50
downstream ENSMUSE00000639661 Chr2:155457215..155457339 TCCAGTTCCTGGATGCTCTT Chr2:155457278..155457297 59.8 50
downstream ENSMUSE00000639660 Chr2:155457450..155457565 ACCTGGGACAACTCCAACTG Chr2:155457511..155457530 60 55
downstream ENSMUSE00000639659 Chr2:155457884..155458280 CTGCGAATGCAGTAGGTTGA Chr2:155458283..155458302 60.01 50
downstream ENSMUSE00000359049 Chr2:155458363..155458488 ATCAGTGATGGCCTTTTTGG Chr2:155458491..155458510 59.93 45
downstream ENSMUSE00000639658 Chr2:155458584..155458754 TCTTCATCCGTTCCAGGTGT Chr2:155458653..155458672 60.51 50
downstream ENSMUSE00000639657 Chr2:155458901..155459005 GCATGCTTTTTCTGCTCTGC Chr2:155458950..155458969 61.2 50
downstream ENSMUSE00000639656 Chr2:155459089..155459184 AGCCAGGTTCTTCCTGTCCT Chr2:155459118..155459137 60.25 55
downstream ENSMUSE00000639655 Chr2:155459599..155459736 TTGCGGTACTTAGCCAGGTT Chr2:155459639..155459658 59.77 50
downstream ENSMUSE00000681103 Chr2:155459816..155459827 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTGTGGAAGGAGGGACAGAG Chr2:155443688..155443708 59.68 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTGGAAGGAGGGACAGAG Chr2:155443688..155443708 59.68 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000074652