Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28929
Trapped Gene
1700057K13Rik (ENSMUSG00000026592)
Vector Insertion
Chr 1: 159030656 - 159034474
Public Clones not available
Private Clones OST15789 (lexicon)
Severity of mutation (?) Insertion after 43% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000274675 (Chr1:159034475..159034534 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000274675 (Chr1:159034475..159034534 -)
Downstram Exon
ENSMUSE00000274668 (Chr1:159030591..159030655 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000712174 Chr1:159038784..159038811 No primer for this exon
upstream ENSMUSE00000160827 Chr1:159038662..159038781 TCCATCATGTCAGCCAAGAA Chr1:159038687..159038706 60.2 45
upstream ENSMUSE00000714226 Chr1:159038662..159038776 TCCATCATGTCAGCCAAGAA Chr1:159038687..159038706 60.2 45
upstream ENSMUSE00000711985 Chr1:159038456..159038519 No primer for this exon
upstream ENSMUSE00000160826 Chr1:159037974..159038018 ACTACAAGGCTGTTTGCATGG Chr1:159037991..159038011 60.18 47.62
upstream ENSMUSE00000160822 Chr1:159037321..159037389 CTCATCAGAAAAGGGATGACG Chr1:159037333..159037353 59.68 47.62
upstream ENSMUSE00000160824 Chr1:159035162..159035218 ACGAACTCAGGGAGGTGAGA Chr1:159035198..159035217 59.83 55
upstream ENSMUSE00000274675 Chr1:159034475..159034534 No primer for this exon

*** Putative Vector Insertion (Chr 1: 159030656 - 159034474) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000274668 Chr1:159030591..159030655 No primer for this exon
downstream ENSMUSE00000160825 Chr1:159030211..159030394 CAGTGGATTCCTCGTTGGTT Chr1:159030219..159030238 59.97 50
downstream ENSMUSE00000160820 Chr1:159029835..159029878 GATTGCGGTTGGTCTTTAGG Chr1:159029817..159029836 59.57 50
downstream ENSMUSE00000711166 Chr1:159029444..159029534 ACCTCGGCGAAGTTGAAGTA Chr1:159029424..159029443 59.88 50
downstream ENSMUSE00000711375 Chr1:159029285..159029537 ACCTCGGCGAAGTTGAAGTA Chr1:159029424..159029443 59.88 50
downstream ENSMUSE00000715874 Chr1:159029279..159029537 ACCTCGGCGAAGTTGAAGTA Chr1:159029424..159029443 59.88 50
downstream ENSMUSE00000160821 Chr1:159029278..159029534 ACCTCGGCGAAGTTGAAGTA Chr1:159029424..159029443 59.88 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GAGTAATCGCCTTGCAGCAC Chr1:159031406..159031426 60.94 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCTGACCGGAAGGAGATT Chr1:159031444..159031464 59.65 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026592