Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2895
Trapped Gene
Eif4ebp1 (ENSMUSG00000031490)
Vector Insertion
Chr 8: 28371023 - 28383794
Public Clones AD0708 (sanger) (sanger) (sanger) AB0132 (sanger) (sanger)
(sanger) CSG084 (baygenomics) CSI620 (baygenomics) RHA152 (baygenomics)
YHD106 (baygenomics) XB452 (baygenomics) YTA015 (baygenomics) (ggtc)
CMHD-GT_437A3-3 (cmhd) IST14380H2 (tigm) IST11468G9 (tigm) IST10749E2 (tigm)
IST13606E9 (tigm) IST14487H7 (tigm) IST12078F7 (tigm) IST13132A7 (tigm)
Private Clones OST468005 (lexicon) OST457865 (lexicon) OST429005 (lexicon) OST401922 (lexicon)
OST398921 (lexicon) OST361122 (lexicon) OST350380 (lexicon) OST290284 (lexicon)
OST207656 (lexicon) OST204350 (lexicon) OST198046 (lexicon) OST108222 (lexicon)
OST99483 (lexicon) OST40251 (lexicon)
Severity of mutation (?) Insertion after 40% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000210026 (Chr8:28370850..28371022 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGGACTACAGCACCACTCC Chr8:28370971..28370990 61.9 65 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000210026 (Chr8:28370850..28371022 +)
Downstram Exon
ENSMUSE00000210028 (Chr8:28383795..28383974 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGGACTACAGCACCACTCC Chr8:28370971..28370990 61.9 65 GGTGAGTTCCGACACTCCAT Chr8:28383849..28383868 59.97 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000210026 Chr8:28370850..28371022 GGGGACTACAGCACCACTCC Chr8:28370971..28370990 61.9 65

*** Putative Vector Insertion (Chr 8: 28371023 - 28383794) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000210028 Chr8:28383795..28383974 GGTGAGTTCCGACACTCCAT Chr8:28383849..28383868 59.97 55
downstream ENSMUSE00000224813 Chr8:28385552..28385985 TACGGCTGGTCCCTTAAATG Chr8:28385599..28385618 59.95 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTGAAGAGTCCCCACTTTGG Chr8:28370992..28371012 59.69 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCCAAACACACCCCTCTT Chr8:28371036..28371056 60.4 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000031490