Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28951
Trapped Gene
Ddx59 (ENSMUSG00000026404)
Vector Insertion
Chr 1: 138331212 - 138336329
Public Clones not available
Private Clones OST15161 (lexicon)
Severity of mutation (?) Insertion after 86% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000234115 (Chr1:138331083..138331211 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTATGAGGTCGTGGTGAGCA Chr1:138331100..138331119 59.85 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000234115 (Chr1:138331083..138331211 +)
Downstram Exon
ENSMUSE00000234109 (Chr1:138336330..138336728 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTATGAGGTCGTGGTGAGCA Chr1:138331100..138331119 59.85 55 TCCATTTTGACCGAGTCTCC Chr1:138336365..138336384 60.05 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000234159 Chr1:138311848..138312000 No primer for this exon
upstream ENSMUSE00000234151 Chr1:138313159..138313973 ACCCTCAAGGAGGACCAGAT Chr1:138313695..138313714 59.93 55
upstream ENSMUSE00000158758 Chr1:138315987..138316154 TTCTCGTAGGGGGCTTACCT Chr1:138316096..138316115 60.09 55
upstream ENSMUSE00000234138 Chr1:138321372..138321461 ATAGCAACCCCTGGACGACT Chr1:138321378..138321397 60.9 55
upstream ENSMUSE00000234131 Chr1:138328889..138329140 CAAGTGCTTGACGTTTTGGA Chr1:138328922..138328941 59.88 45
upstream ENSMUSE00000234123 Chr1:138330290..138330442 ACTGCAAACTAGGCGCAGAT Chr1:138330330..138330349 60.04 50
upstream ENSMUSE00000234115 Chr1:138331083..138331211 CTATGAGGTCGTGGTGAGCA Chr1:138331100..138331119 59.85 55

*** Putative Vector Insertion (Chr 1: 138331212 - 138336329) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000234109 Chr1:138336330..138336728 TCCATTTTGACCGAGTCTCC Chr1:138336365..138336384 60.05 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCTTCAAGCATGGATGAGT Chr1:138334182..138334202 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCTTCAAGCATGGATGAGT Chr1:138331182..138331202 60.23 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026404