Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28960
Trapped Gene
Fabp1 (ENSMUSG00000054422)
Vector Insertion
Chr 6: 71153174 - 71154897
Public Clones not available
Private Clones OST14941 (lexicon)
Severity of mutation (?) Insertion after 88% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000457952 (Chr6:71153081..71153173 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAGTCGTCAAGCTGGAAGGT Chr6:71153082..71153101 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000457952 (Chr6:71153081..71153173 +)
Downstram Exon
ENSMUSE00000457969 (Chr6:71154898..71155013 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAGTCGTCAAGCTGGAAGGT Chr6:71153082..71153101 60.44 55 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000457984 Chr6:71149873..71149987 AGCTGTTGTGGTCAGCTGTG Chr6:71149879..71149898 60.1 55
upstream ENSMUSE00000457959 Chr6:71151602..71151774 GAGGAGTGCGAACTGGAGAC Chr6:71151733..71151752 59.99 60
upstream ENSMUSE00000457952 Chr6:71153081..71153173 CAGTCGTCAAGCTGGAAGGT Chr6:71153082..71153101 60.44 55

*** Putative Vector Insertion (Chr 6: 71153174 - 71154897) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000457969 Chr6:71154898..71155013 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACGGTACGTAATCGCCTTG Chr6:71153216..71153236 60.02 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGTTGACCCTCTGGTCTTGC Chr6:71153178..71153198 59.31 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000054422