Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28961
Trapped Gene
Pcsk1n (ENSMUSG00000039278)
Vector Insertion
Chr X: 7499641 - 7500033
Public Clones IST13367G3 (tigm)
Private Clones OST14910 (lexicon)
Severity of mutation (?) Insertion after 75% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000482117 (ChrX:7499174..7499640 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCTTGGTTGAGACGAGCACT ChrX:7499205..7499224 60.44 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000482117 (ChrX:7499174..7499640 +)
Downstram Exon
ENSMUSE00000624960 (ChrX:7500034..7500360 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCTTGGTTGAGACGAGCACT ChrX:7499205..7499224 60.44 55 AGGATCCGCCCTAGCAAGTA ChrX:7500057..7500076 61.1 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000482889 ChrX:7497021..7497170 ATTTTGGTGCTGCTGCTCTT ChrX:7497105..7497124 60.02 45
upstream ENSMUSE00000482117 ChrX:7499174..7499640 CCTTGGTTGAGACGAGCACT ChrX:7499205..7499224 60.44 55

*** Putative Vector Insertion (Chr X: 7499641 - 7500033) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000624960 ChrX:7500034..7500360 AGGATCCGCCCTAGCAAGTA ChrX:7500057..7500076 61.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGGCTTCATGCACTTAATCG ChrX:7499678..7499698 60.61 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector

Come back to gene ENSMUSG00000039278