Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28962
Trapped Gene
Gm749 (ENSMUSG00000024224)
Vector Insertion
Chr 17: 28687724 - 28689359
Public Clones not available
Private Clones OST14897 (lexicon) OST6798 (lexicon)
Severity of mutation (?) Insertion after 70% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000241057 (Chr17:28687601..28687723 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTCCAGTGACTGTTGCCTCA Chr17:28687636..28687655 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000241057 (Chr17:28687601..28687723 +)
Downstram Exon
ENSMUSE00000139974 (Chr17:28689360..28689563 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTCCAGTGACTGTTGCCTCA Chr17:28687636..28687655 60.02 55 AGGAGTCGATGTGGAGTTGG Chr17:28689545..28689564 60.11 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610028 Chr17:28686430..28686548 CATCATGGCATTCACTCAGG Chr17:28686455..28686474 60.07 50
upstream ENSMUSE00000241057 Chr17:28687601..28687723 CTCCAGTGACTGTTGCCTCA Chr17:28687636..28687655 60.02 55

*** Putative Vector Insertion (Chr 17: 28687724 - 28689359) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000139974 Chr17:28689360..28689563 AGGAGTCGATGTGGAGTTGG Chr17:28689545..28689564 60.11 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAGACCGTGACTGGGAAAA Chr17:28687769..28687789 59.7 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000024224