Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28976
Trapped Gene
Hipk4 (ENSMUSG00000040424)
Vector Insertion
Chr 7: 28313314 - 28313672
Public Clones not available
Private Clones OST14486 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000306544 (Chr7:28312078..28313671 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGTGCGCTACATCTGTGAGA Chr7:28313518..28313537 60.02 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000306544 (Chr7:28312078..28313671 +)
Downstram Exon
ENSMUSE00000676382 (Chr7:28313315..28313671 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGTGCGCTACATCTGTGAGA Chr7:28313518..28313537 60.02 55 TGTAGCGCACCTGGTCATAC Chr7:28313531..28313550 59.75 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676383 Chr7:28308536..28309000 AAGAACGATGCGTACCGAAG Chr7:28308662..28308681 60.27 50
upstream ENSMUSE00000306544 Chr7:28312078..28313671 GGTGCGCTACATCTGTGAGA Chr7:28313518..28313537 60.02 55

*** Putative Vector Insertion (Chr 7: 28313314 - 28313672) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000676382 Chr7:28313315..28313671 TGTAGCGCACCTGGTCATAC Chr7:28313531..28313550 59.75 55
downstream ENSMUSE00000306538 Chr7:28313968..28314816 CACTTTGAGTGGAACCAGCA Chr7:28314528..28314547 59.87 50
downstream ENSMUSE00000397059 Chr7:28315707..28316191 CCTGACGACCTCCAACATTT Chr7:28316085..28316104 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CATCCCCTCTGTCCTCCATA Chr7:28313295..28313315 59.88 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CATCCCCTCTGTCCTCCATA Chr7:28313295..28313315 59.88 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040424