Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28981
Trapped Gene
Ethe1 (ENSMUSG00000064254)
Vector Insertion
Chr 7: 25380168 - 25391223
Public Clones IST10988H1 (tigm)
Private Clones OST14162 (lexicon)
Severity of mutation (?) Insertion after 49% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000517307 (Chr7:25380019..25380167 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATATCGGGGAAGGTGATTCC Chr7:25380130..25380149 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000517307 (Chr7:25380019..25380167 +)
Downstram Exon
ENSMUSE00000519367 (Chr7:25391224..25391353 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATATCGGGGAAGGTGATTCC Chr7:25380130..25380149 59.98 50 CGTTCAGGACAAAGGTGACA Chr7:25391287..25391306 59.72 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000598594 Chr7:25372562..25372826 ACCCAGCTGGCAAGTTAGTG Chr7:25372755..25372774 60.31 55
upstream ENSMUSE00000513897 Chr7:25378646..25379030 TCCCGTGGCTCTAAGTGTCT Chr7:25378683..25378702 59.87 55
upstream ENSMUSE00000515873 Chr7:25379437..25379581 GTGACCGGGAGTCAAGAGAG Chr7:25379477..25379496 59.83 60
upstream ENSMUSE00000517307 Chr7:25380019..25380167 ATATCGGGGAAGGTGATTCC Chr7:25380130..25380149 59.98 50

*** Putative Vector Insertion (Chr 7: 25380168 - 25391223) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000519367 Chr7:25391224..25391353 CGTTCAGGACAAAGGTGACA Chr7:25391287..25391306 59.72 50
downstream ENSMUSE00000473928 Chr7:25392887..25392976 GTAATCGTGAGCCGGGTAGA Chr7:25392975..25392994 60.1 55
downstream ENSMUSE00000506721 Chr7:25393371..25393487 TAAGCCGTGGGTTCAGAGTC Chr7:25393424..25393443 60.26 55
downstream ENSMUSE00000507281 Chr7:25393742..25393942 TCACCCCTCCTAGTGCATTC Chr7:25393848..25393867 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTTCCAAGTTCCAGCTAATCG Chr7:25389204..25389225 59.35 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACGCTTTGTGAGTTGGGTCT Chr7:25380162..25380182 59.77 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000064254