Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28982
Trapped Gene
Kdelc2 (ENSMUSG00000034487)
Vector Insertion
Chr 9: 53206130 - 53207791
Public Clones IST12834F2 (tigm) IST12442F9 (tigm) IST11959H7 (tigm) IST12834F2 (tigm)
Private Clones OST14157 (lexicon) OST14155 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000278781 (Chr9:53206025..53206129 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTGCGAAAGAAGGGCAGTTA Chr9:53206050..53206069 60.88 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000278781 (Chr9:53206025..53206129 +)
Downstram Exon
ENSMUSE00000346347 (Chr9:53207792..53209972 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTGCGAAAGAAGGGCAGTTA Chr9:53206050..53206069 60.88 45 GTGCAATGTTCCAAGGTGTG Chr9:53208935..53208954 60.01 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000392542 Chr9:53192128..53192391 GGCCGGAACTTCACTAGCTC Chr9:53192364..53192383 61.29 60
upstream ENSMUSE00000278889 Chr9:53196485..53196682 GATACAGGATGCACGAGACG Chr9:53196590..53196609 59.27 55
upstream ENSMUSE00000278863 Chr9:53198540..53198826 AGGAGGTCCCCACAAGATTT Chr9:53198681..53198700 59.79 50
upstream ENSMUSE00000278841 Chr9:53200020..53200236 CCTTGGAGCATCGAAAAGTC Chr9:53200066..53200085 59.81 50
upstream ENSMUSE00000278823 Chr9:53202041..53202237 AGAGATAGCCGGGAGGAGAG Chr9:53202085..53202104 59.94 60
upstream ENSMUSE00000278807 Chr9:53203949..53204143 CTGGTCCTCAAGCAGGAGTC Chr9:53204021..53204040 59.99 60
upstream ENSMUSE00000278781 Chr9:53206025..53206129 TTGCGAAAGAAGGGCAGTTA Chr9:53206050..53206069 60.88 45

*** Putative Vector Insertion (Chr 9: 53206130 - 53207791) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000346347 Chr9:53207792..53209972 GTGCAATGTTCCAAGGTGTG Chr9:53208935..53208954 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GGTCCCTATACCACCGTGAC Chr9:53206167..53206187 59.14 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034487