Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28985
Trapped Gene
Lrrc46 (ENSMUSG00000020878)
Vector Insertion
Chr 11: 96897831 - 96900085
Public Clones not available
Private Clones OST13945 (lexicon)
Severity of mutation (?) Insertion after 25% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000111048 (Chr11:96900086..96900194 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000111048 (Chr11:96900086..96900194 -)
Downstram Exon
ENSMUSE00000111045 (Chr11:96897784..96897830 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000289096 Chr11:96902397..96902658 No primer for this exon
upstream ENSMUSE00000111046 Chr11:96902181..96902286 No primer for this exon
upstream ENSMUSE00000111048 Chr11:96900086..96900194 No primer for this exon

*** Putative Vector Insertion (Chr 11: 96897831 - 96900085) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000111045 Chr11:96897784..96897830 No primer for this exon
downstream ENSMUSE00000111044 Chr11:96897410..96897519 No primer for this exon
downstream ENSMUSE00000111051 Chr11:96897186..96897255 No primer for this exon
downstream ENSMUSE00000111047 Chr11:96896773..96896918 No primer for this exon
downstream ENSMUSE00000368394 Chr11:96895912..96896338 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACAGCCTCTACCTGCAATCG Chr11:96900084..96900104 60.42 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACAGCCTCTACCTGCAATCG Chr11:96900084..96900104 60.42 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000020878