Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28989
Trapped Gene
Pcsk1n (ENSMUSG00000039278)
Vector Insertion
Chr X: 7497171 - 7499173
Public Clones IST15056C4 (tigm) IST11629D5 (tigm) IST13030D7 (tigm) IST14040A7 (tigm)
Private Clones OST13846 (lexicon)
Severity of mutation (?) Insertion after 15% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000482889 (ChrX:7497021..7497170 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATTTTGGTGCTGCTGCTCTT ChrX:7497105..7497124 60.02 45 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000482889 (ChrX:7497021..7497170 +)
Downstram Exon
ENSMUSE00000482117 (ChrX:7499174..7499640 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATTTTGGTGCTGCTGCTCTT ChrX:7497105..7497124 60.02 45 AGTGCTCGTCTCAACCAAGG ChrX:7499227..7499246 60.44 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000482889 ChrX:7497021..7497170 ATTTTGGTGCTGCTGCTCTT ChrX:7497105..7497124 60.02 45

*** Putative Vector Insertion (Chr X: 7497171 - 7499173) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000482117 ChrX:7499174..7499640 AGTGCTCGTCTCAACCAAGG ChrX:7499227..7499246 60.44 55
downstream ENSMUSE00000624960 ChrX:7500034..7500360 AGGATCCGCCCTAGCAAGTA ChrX:7500057..7500076 61.1 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGGTGCGACCTCAGTCAGC ChrX:7497169..7497189 62.92 60 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTGCGACCTCAGTCAGC ChrX:7497169..7497189 62.92 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000039278