Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2899
Trapped Gene
Rpa1 (ENSMUSG00000000751)
Vector Insertion
Chr 11: 75155697 - 75161727
Public Clones (sanger) AD0650 (sanger) (sanger) (sanger) CSH594 (baygenomics) RRK137 (baygenomics)
CSH524 (baygenomics) RRK136 (baygenomics) D129A06 (ggtc)
Private Clones OST454871 (lexicon) OST448599 (lexicon) OST385802 (lexicon) OST353867 (lexicon)
OST353866 (lexicon) OST318438 (lexicon) OST307151 (lexicon) OST277071 (lexicon)
OST201210 (lexicon)
Severity of mutation (?) Insertion after 2% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000300027 (Chr11:75161728..75161837 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000300027 (Chr11:75161728..75161837 -)
Downstram Exon
ENSMUSE00000300025 (Chr11:75155646..75155696 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000300027 Chr11:75161728..75161837 No primer for this exon

*** Putative Vector Insertion (Chr 11: 75155697 - 75161727) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000300025 Chr11:75155646..75155696 No primer for this exon
downstream ENSMUSE00000300021 Chr11:75154530..75154608 No primer for this exon
downstream ENSMUSE00000300017 Chr11:75153792..75153900 No primer for this exon
downstream ENSMUSE00000578412 Chr11:75153215..75153277 No primer for this exon
downstream ENSMUSE00000300014 Chr11:75142175..75142263 No primer for this exon
downstream ENSMUSE00000300011 Chr11:75131914..75132033 No primer for this exon
downstream ENSMUSE00000650776 Chr11:75129607..75129739 No primer for this exon
downstream ENSMUSE00000650775 Chr11:75128315..75128417 No primer for this exon
downstream ENSMUSE00000650774 Chr11:75126803..75126871 No primer for this exon
downstream ENSMUSE00000650773 Chr11:75126480..75126672 No primer for this exon
downstream ENSMUSE00000650772 Chr11:75126195..75126334 No primer for this exon
downstream ENSMUSE00000650771 Chr11:75125802..75125950 No primer for this exon
downstream ENSMUSE00000650770 Chr11:75123635..75123767 No primer for this exon
downstream ENSMUSE00000650769 Chr11:75120617..75120793 No primer for this exon
downstream ENSMUSE00000650768 Chr11:75119610..75119717 No primer for this exon
downstream ENSMUSE00000650767 Chr11:75116170..75116256 No primer for this exon
downstream ENSMUSE00000587797 Chr11:75113852..75114905 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTCAGTAATCGCCTTGCAG Chr11:75155681..75155702 60.53 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCATCGAGGTAAGGAGACGA Chr11:75155714..75155734 60.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 TCAGGCGGTGCAAGAGTAAT Chr11:75155783..75155803 60.8 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 CTCTAGCCAATCGTTGAGCA Chr11:75155828..75155848 59.17 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000000751