Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28992
Trapped Gene
Foxa3 (ENSMUSG00000040891)
Vector Insertion
Chr 7: 19600480 - 19608697
Public Clones not available
Private Clones OST13752 (lexicon)
Severity of mutation (?) Insertion after 7% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000399373 (Chr7:19608698..19608888 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGCCGAGTGGAGCTACTA Chr7:19608714..19608733 60.55 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000399373 (Chr7:19608698..19608888 -)
Downstram Exon
ENSMUSE00000236289 (Chr7:19598632..19600479 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGCCGAGTGGAGCTACTA Chr7:19608714..19608733 60.55 60 ATCCAGTTTGGAAGGTGTCG Chr7:19599555..19599574 59.97 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000399373 Chr7:19608698..19608888 CTGGCCGAGTGGAGCTACTA Chr7:19608714..19608733 60.55 60

*** Putative Vector Insertion (Chr 7: 19600480 - 19608697) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000236289 Chr7:19598632..19600479 ATCCAGTTTGGAAGGTGTCG Chr7:19599555..19599574 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTAATCGCCTTGCAGCACATC Chr7:19605626..19605647 62.97 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CTGGCCGAGTGGAGCTACTA Chr7:19605712..19605732 60.55 60 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040891