Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI28994
Trapped Gene
Atp1a3 (ENSMUSG00000040907)
Vector Insertion
Chr 7: 25785800 - 25785938
Public Clones not available
Private Clones OST13706 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000316334 (Chr7:25785939..25785998 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GAGGTCTGCCGGAAATACAA Chr7:25785955..25785974 60.07 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000316334 (Chr7:25785939..25785998 -)
Downstram Exon
ENSMUSE00000316328 (Chr7:25785596..25785799 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GAGGTCTGCCGGAAATACAA Chr7:25785955..25785974 60.07 50 GCTAGGATCTCCTGGGCTTT Chr7:25785743..25785762 59.81 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000391135 Chr7:25790774..25790912 CACCGCTCATCAGTCTGAAC Chr7:25790806..25790825 59.42 55
upstream ENSMUSE00000662829 Chr7:25790774..25790914 CACCGCTCATCAGTCTGAAC Chr7:25790806..25790825 59.42 55
upstream ENSMUSE00000662828 Chr7:25786091..25786177 GGACCTGGATGACCTCAAGA Chr7:25786105..25786124 60.05 55
upstream ENSMUSE00000316334 Chr7:25785939..25785998 GAGGTCTGCCGGAAATACAA Chr7:25785955..25785974 60.07 50

*** Putative Vector Insertion (Chr 7: 25785800 - 25785938) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000316328 Chr7:25785596..25785799 GCTAGGATCTCCTGGGCTTT Chr7:25785743..25785762 59.81 55
downstream ENSMUSE00000535967 Chr7:25783919..25784032 CAGCACTATGCCCAGGTACA Chr7:25783990..25784009 59.74 55
downstream ENSMUSE00000535966 Chr7:25783693..25783827 CCTGCATCTTTTCACCTTCC Chr7:25783769..25783788 59.67 50
downstream ENSMUSE00000316303 Chr7:25782532..25782649 GCAGTTGGTGGAAAAGAAGG Chr7:25782517..25782536 59.71 50
downstream ENSMUSE00000535965 Chr7:25782151..25782419 ATGATGCCGATGAGGAAGAT Chr7:25782169..25782188 59.47 45
downstream ENSMUSE00000535964 Chr7:25779555..25779753 TCGTGGATCTGGTTGTCAAA Chr7:25779559..25779578 60.09 45
downstream ENSMUSE00000598415 Chr7:25779369..25779478 ACCCAGGTGTGTGAGCTCTT Chr7:25779423..25779442 59.76 55
downstream ENSMUSE00000316280 Chr7:25779151..25779285 TTTGTTGGTCGAGTTGAACG Chr7:25779135..25779154 59.73 45
downstream ENSMUSE00000316273 Chr7:25775382..25775574 CCAGGTAGGCATTCTGGAAG Chr7:25775390..25775409 59.69 55
downstream ENSMUSE00000535962 Chr7:25774808..25774983 CATGAGACCCACAAAGCAAA Chr7:25774855..25774874 59.69 45
downstream ENSMUSE00000535961 Chr7:25774587..25774723 CGACAGTCTCGTTACCCTCAG Chr7:25774614..25774634 59.92 57.14
downstream ENSMUSE00000470049 Chr7:25772997..25773147 TCCACGATGATGAGCTTCTG Chr7:25772991..25773010 59.94 50
downstream ENSMUSE00000535958 Chr7:25772454..25772622 AGCAGGGGAGTCATTCACAC Chr7:25772553..25772572 60.12 55
downstream ENSMUSE00000535957 Chr7:25766761..25766915 CAATGCAGAGGATGGTGATG Chr7:25766756..25766775 60.07 50
downstream ENSMUSE00000535956 Chr7:25766538..25766661 TCTTCATGATGTCGCTCTCG Chr7:25766588..25766607 60.1 50
downstream ENSMUSE00000535955 Chr7:25765570..25765715 CATTGACAGTGCGATCATCC Chr7:25765577..25765596 60.08 50
downstream ENSMUSE00000535954 Chr7:25765029..25765159 AAGACGGAGTTCCTCCTGGT Chr7:25765022..25765041 60.11 55
downstream ENSMUSE00000316221 Chr7:25764314..25764415 TCCTCAAACAAGCCGAAGAT Chr7:25764361..25764380 59.81 45
downstream ENSMUSE00000636482 Chr7:25763933..25764024 AAACTGTAGGGGAAGGCACA Chr7:25763967..25763986 59.59 50
downstream ENSMUSE00000662827 Chr7:25763192..25764024 CACAGTCGCACTTGGAAAGA Chr7:25763769..25763788 60.03 50
downstream ENSMUSE00000676681 Chr7:25763192..25763595 GGTAATCGAGGTGTGGGAGA Chr7:25763388..25763407 59.93 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGAAGAGGTCTGCCGGAAAT Chr7:25785957..25785977 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGAGGTCTGCCGGAAAT Chr7:25785957..25785977 60.21 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040907