Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29004
Trapped Gene
Ncaph (ENSMUSG00000034906)
Vector Insertion
Chr 2: 126931932 - 126933089
Public Clones not available
Private Clones OST13384 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000320639 (Chr2:126933090..126933206 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCCAAAAAGATGGACATGA Chr2:126933155..126933174 60.05 40 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000320639 (Chr2:126933090..126933206 -)
Downstram Exon
ENSMUSE00000320635 (Chr2:126931840..126931931 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCCAAAAAGATGGACATGA Chr2:126933155..126933174 60.05 40 TTGTCTGCAGGTCCTTTGTG Chr2:126931819..126931838 59.87 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000708433 Chr2:126959585..126959652 CTTACTCCGGAGACGTGGAG Chr2:126959610..126959629 59.86 60
upstream ENSMUSE00000719334 Chr2:126959585..126959652 CTTACTCCGGAGACGTGGAG Chr2:126959610..126959629 59.86 60
upstream ENSMUSE00000320738 Chr2:126953221..126953458 GCTCCACTTGGCACTCCTAA Chr2:126953344..126953363 60.4 55
upstream ENSMUSE00000683747 Chr2:126953221..126953458 GCTCCACTTGGCACTCCTAA Chr2:126953344..126953363 60.4 55
upstream ENSMUSE00000320729 Chr2:126952840..126952930 No primer for this exon
upstream ENSMUSE00000320721 Chr2:126951851..126951943 CTTTCGGCTTGCATTTGATT Chr2:126951905..126951924 60.21 40
upstream ENSMUSE00000320713 Chr2:126951287..126951422 CTATGCTGTCCGTGTGGATG Chr2:126951368..126951387 60.14 55
upstream ENSMUSE00000320704 Chr2:126950567..126950691 TCCTGCAAAACCATTGAACA Chr2:126950613..126950632 60.09 40
upstream ENSMUSE00000320698 Chr2:126949273..126949462 TTGATGAATGCAGCACGACT Chr2:126949409..126949428 60.42 45
upstream ENSMUSE00000320691 Chr2:126947776..126947867 AATGGGACAGCGAAACACAT Chr2:126947782..126947801 60.38 45
upstream ENSMUSE00000320681 Chr2:126946861..126947063 TGGAAGGAGCTCTGTCAGGT Chr2:126946873..126946892 59.99 55
upstream ENSMUSE00000320672 Chr2:126943813..126943961 CCCTCGAGGACAGAGACATC Chr2:126943928..126943947 59.79 60
upstream ENSMUSE00000320665 Chr2:126943242..126943348 TACCTCCTGCACAGAGCACA Chr2:126943322..126943341 60.62 55
upstream ENSMUSE00000320657 Chr2:126942268..126942390 TTGGAAAGCCACCACTCTTC Chr2:126942330..126942349 60.23 50
upstream ENSMUSE00000320650 Chr2:126939296..126939406 AACCCTAACGACACCTCCAA Chr2:126939315..126939334 59.45 50
upstream ENSMUSE00000320646 Chr2:126934221..126934394 GGGACCCTTGACCTTGAGTC Chr2:126934324..126934343 60.89 60
upstream ENSMUSE00000320639 Chr2:126933090..126933206 TGCCAAAAAGATGGACATGA Chr2:126933155..126933174 60.05 40

*** Putative Vector Insertion (Chr 2: 126931932 - 126933089) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000320635 Chr2:126931840..126931931 TTGTCTGCAGGTCCTTTGTG Chr2:126931819..126931838 59.87 50
downstream ENSMUSE00000320629 Chr2:126931582..126931657 AAAGCCAGGGGTATGGAGAG Chr2:126931591..126931610 60.46 55
downstream ENSMUSE00000346917 Chr2:126929567..126930016 GTGGGACGGTCACAGAAAGT Chr2:126929683..126929702 60.01 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGGAAGGAGGCTGACACAGA Chr2:126933089..126933109 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAGCTCGTGACTGGGAAAA Chr2:126933024..126933044 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000034906