Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2902
Trapped Gene
Zfp295 (ENSMUSG00000046962)
Vector Insertion
Chr 16: 98174259 - 98177922
Public Clones AD0631 (sanger)
Private Clones not available
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000408116 (Chr16:98177923..98178065 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACAAACACTCGGGAGAGGAA Chr16:98177950..98177969 59.7 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000408116 (Chr16:98177923..98178065 -)
Downstram Exon
ENSMUSE00000458149 (Chr16:98172635..98174258 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACAAACACTCGGGAGAGGAA Chr16:98177950..98177969 59.7 50 ATCAGGAGCACGTCACACAG Chr16:98174121..98174140 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000458143 Chr16:98183579..98183786 GGCTGAAGAGCGGTGAGTAA Chr16:98183670..98183689 60.54 55
upstream ENSMUSE00000408116 Chr16:98177923..98178065 ACAAACACTCGGGAGAGGAA Chr16:98177950..98177969 59.7 50

*** Putative Vector Insertion (Chr 16: 98174259 - 98177922) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000458149 Chr16:98172635..98174258 ATCAGGAGCACGTCACACAG Chr16:98174121..98174140 59.9 55
downstream ENSMUSE00000508506 Chr16:98168599..98172034 AGACTGAAGGCCGTCTTGAA Chr16:98171052..98171071 59.99 50
downstream ENSMUSE00000518992 Chr16:98168599..98174258 AGACTGAAGGCCGTCTTGAA Chr16:98171052..98171071 59.99 50
downstream ENSMUSE00000696826 Chr16:98168599..98174258 AGACTGAAGGCCGTCTTGAA Chr16:98171052..98171071 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAACACTCGGGAGAGGAAG Chr16:98177947..98177967 59.84 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAACACTCGGGAGAGGAAG Chr16:98177947..98177967 59.84 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000046962