Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29029
Trapped Gene
Gm1123 (ENSMUSG00000044860)
Vector Insertion
Chr 9: 98907486 - 98909645
Public Clones CMHD-GT_414B9-3 (cmhd)
Private Clones OST11872 (lexicon)
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000583548 (Chr9:98909646..98909850 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGCACCTATCAGTGTGGA Chr9:98909698..98909717 59.7 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000583548 (Chr9:98909646..98909850 -)
Downstram Exon
ENSMUSE00000693630 (Chr9:98907212..98907485 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGCACCTATCAGTGTGGA Chr9:98909698..98909717 59.7 55 GTAACCTCTGGGGCAGATGA Chr9:98907439..98907458 60.07 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000634844 Chr9:98936000..98936134 TGTTCCTGTGTGGAGTCACG Chr9:98936001..98936020 60.78 55
upstream ENSMUSE00000693633 Chr9:98923662..98923831 AAGGACCGTTGGACATTGAG Chr9:98923707..98923726 59.97 50
upstream ENSMUSE00000583551 Chr9:98918803..98919007 TGAGAGGGCGAGTGAATTTT Chr9:98918939..98918958 59.81 45
upstream ENSMUSE00000693632 Chr9:98916383..98916552 AAGGACCGTTGAACATCGAG Chr9:98916428..98916447 60.11 50
upstream ENSMUSE00000360801 Chr9:98914452..98914656 AAATGTCCAGCTCTCGGATG Chr9:98914524..98914543 60.22 50
upstream ENSMUSE00000583549 Chr9:98911380..98911549 TCATTGACTGGATGCAGCTT Chr9:98911413..98911432 59.4 45
upstream ENSMUSE00000583548 Chr9:98909646..98909850 CTGGCACCTATCAGTGTGGA Chr9:98909698..98909717 59.7 55

*** Putative Vector Insertion (Chr 9: 98907486 - 98909645) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000693630 Chr9:98907212..98907485 GTAACCTCTGGGGCAGATGA Chr9:98907439..98907458 60.07 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GTCCCATGCCTTTGGTACTG Chr9:98909674..98909694 60.38 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTCCCATGCCTTTGGTACTG Chr9:98909674..98909694 60.38 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044860