Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29030
Trapped Gene
Cryga (ENSMUSG00000044429)
Vector Insertion
Chr 1: 65147300 - 65149554
Public Clones CMHD-GT_391D2-3 (cmhd)
Private Clones OST11812 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000363749 (Chr1:65149555..65149797 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCCTGACTACCAGCAGTGG Chr1:65149600..65149619 60.17 60 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000363749 (Chr1:65149555..65149797 -)
Downstram Exon
ENSMUSE00000409464 (Chr1:65146968..65147299 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCCTGACTACCAGCAGTGG Chr1:65149600..65149619 60.17 60 AAATCCATGACCCGTCTCAG Chr1:65147012..65147031 59.93 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000489820 Chr1:65149903..65149924 TGTCAACAACGATGGGAAAG Chr1:65149903..65149922 59.54 45
upstream ENSMUSE00000363749 Chr1:65149555..65149797 ACCCTGACTACCAGCAGTGG Chr1:65149600..65149619 60.17 60

*** Putative Vector Insertion (Chr 1: 65147300 - 65149554) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000409464 Chr1:65146968..65147299 AAATCCATGACCCGTCTCAG Chr1:65147012..65147031 59.93 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCTGGCTGATGTGAGAGA Chr1:65149519..65149539 61.12 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CACTAGGTCTTCCTGCGTGAC Chr1:65149497..65149518 59.92 57.14 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000044429