Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29033
Trapped Gene
Gapvd1 (ENSMUSG00000026867)
Vector Insertion
Chr 2: 34556371 - 34559685
Public Clones not available
Private Clones OST11747 (lexicon)
Severity of mutation (?) Insertion after 9% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000694294 (Chr2:34559686..34559906 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GTCATCTTCGTCCCCGAGTA Chr2:34559706..34559725 60.07 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000694294 (Chr2:34559686..34559906 -)
Downstram Exon
ENSMUSE00000163679 (Chr2:34556283..34556370 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GTCATCTTCGTCCCCGAGTA Chr2:34559706..34559725 60.07 55 GTCACTGTCCTTGCGTTCCT Chr2:34556325..34556344 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000662650 Chr2:34610498..34610752 GCTGTCAAGTGGGAACCAAT Chr2:34610723..34610742 59.97 50
upstream ENSMUSE00000444233 Chr2:34609786..34610081 AGGTACACGGAGACGTGAGG Chr2:34610056..34610075 60.17 60
upstream ENSMUSE00000662649 Chr2:34609786..34610079 AGGTACACGGAGACGTGAGG Chr2:34610056..34610075 60.17 60
upstream ENSMUSE00000708319 Chr2:34585983..34586200 ACCTCAAGCAGGAACGCTTA Chr2:34586114..34586133 60.01 50
upstream ENSMUSE00000717865 Chr2:34585983..34586200 ACCTCAAGCAGGAACGCTTA Chr2:34586114..34586133 60.01 50
upstream ENSMUSE00000720919 Chr2:34585983..34586200 ACCTCAAGCAGGAACGCTTA Chr2:34586114..34586133 60.01 50
upstream ENSMUSE00000411944 Chr2:34583851..34584694 TGCAGTTGTCAATCCAGAGC Chr2:34583910..34583929 59.99 50
upstream ENSMUSE00000708314 Chr2:34583851..34584694 TGCAGTTGTCAATCCAGAGC Chr2:34583910..34583929 59.99 50
upstream ENSMUSE00000714503 Chr2:34583851..34584694 TGCAGTTGTCAATCCAGAGC Chr2:34583910..34583929 59.99 50
upstream ENSMUSE00000368892 Chr2:34582736..34582822 GCAGCAGCTAGCAATGACTG Chr2:34582789..34582808 59.92 55
upstream ENSMUSE00000694313 Chr2:34582736..34582822 GCAGCAGCTAGCAATGACTG Chr2:34582789..34582808 59.92 55
upstream ENSMUSE00000349487 Chr2:34580899..34581033 GTGTCGCTGCTTTCCTTGAT Chr2:34581010..34581029 60.41 50
upstream ENSMUSE00000694312 Chr2:34580899..34581033 GTGTCGCTGCTTTCCTTGAT Chr2:34581010..34581029 60.41 50
upstream ENSMUSE00000384738 Chr2:34580563..34580752 TCAGATGTCTCCAGCAACCA Chr2:34580596..34580615 60.4 50
upstream ENSMUSE00000694311 Chr2:34580563..34580752 TCAGATGTCTCCAGCAACCA Chr2:34580596..34580615 60.4 50
upstream ENSMUSE00000346281 Chr2:34576088..34576248 CCAGGAGGTACAGCCAGAAG Chr2:34576153..34576172 59.86 60
upstream ENSMUSE00000694310 Chr2:34576088..34576248 CCAGGAGGTACAGCCAGAAG Chr2:34576153..34576172 59.86 60
upstream ENSMUSE00000261478 Chr2:34572836..34572902 AAACATGCAGCTTTCGGATG Chr2:34572878..34572897 61.17 45
upstream ENSMUSE00000694306 Chr2:34572836..34572902 AAACATGCAGCTTTCGGATG Chr2:34572878..34572897 61.17 45
upstream ENSMUSE00000694290 Chr2:34572773..34572902 CAAACTCCACGGTAAACCTGA Chr2:34572826..34572846 60.02 47.62
upstream ENSMUSE00000694328 Chr2:34572773..34572817 CCCTCTGCAGTGATAATCTGG Chr2:34572788..34572808 59.7 52.38
upstream ENSMUSE00000332968 Chr2:34570725..34570850 TCGGTGTCTTCTCTCGACCT Chr2:34570811..34570830 59.99 55
upstream ENSMUSE00000694326 Chr2:34570725..34570850 TCGGTGTCTTCTCTCGACCT Chr2:34570811..34570830 59.99 55
upstream ENSMUSE00000368194 Chr2:34567685..34567858 TGAGACCTGGAGCACTGATG Chr2:34567742..34567761 59.98 55
upstream ENSMUSE00000708424 Chr2:34567685..34567858 TGAGACCTGGAGCACTGATG Chr2:34567742..34567761 59.98 55
upstream ENSMUSE00000709268 Chr2:34567685..34567858 TGAGACCTGGAGCACTGATG Chr2:34567742..34567761 59.98 55
upstream ENSMUSE00000413822 Chr2:34564632..34564772 GGTAGTTTGCTGTGCCTTCC Chr2:34564730..34564749 59.74 55
upstream ENSMUSE00000694303 Chr2:34564632..34564772 GGTAGTTTGCTGTGCCTTCC Chr2:34564730..34564749 59.74 55
upstream ENSMUSE00000694321 Chr2:34564632..34564778 GGTAGTTTGCTGTGCCTTCC Chr2:34564730..34564749 59.74 55
upstream ENSMUSE00000261581 Chr2:34562218..34562352 GCTGGAGAGCTGTTCTGGAC Chr2:34562296..34562315 60.14 60
upstream ENSMUSE00000694320 Chr2:34562218..34562352 GCTGGAGAGCTGTTCTGGAC Chr2:34562296..34562315 60.14 60
upstream ENSMUSE00000261575 Chr2:34561540..34561659 TTGGGGGCAAAGATTCTGTA Chr2:34561571..34561590 60.44 45
upstream ENSMUSE00000694300 Chr2:34561540..34561659 TTGGGGGCAAAGATTCTGTA Chr2:34561571..34561590 60.44 45
upstream ENSMUSE00000694319 Chr2:34561533..34561659 TTGGGGGCAAAGATTCTGTA Chr2:34561571..34561590 60.44 45
upstream ENSMUSE00000261566 Chr2:34560156..34560233 TGCCATGTTTGATCCACTGT Chr2:34560168..34560187 59.97 45
upstream ENSMUSE00000694297 Chr2:34560156..34560233 TGCCATGTTTGATCCACTGT Chr2:34560168..34560187 59.97 45
upstream ENSMUSE00000694318 Chr2:34560156..34560300 GTGGCTGATCTCATGGTGTG Chr2:34560248..34560267 60.12 55
upstream ENSMUSE00000510072 Chr2:34559686..34560050 GTCATCTTCGTCCCCGAGTA Chr2:34559706..34559725 60.07 55
upstream ENSMUSE00000694294 Chr2:34559686..34559906 GTCATCTTCGTCCCCGAGTA Chr2:34559706..34559725 60.07 55
upstream ENSMUSE00000694295 Chr2:34559686..34560050 GTCATCTTCGTCCCCGAGTA Chr2:34559706..34559725 60.07 55

*** Putative Vector Insertion (Chr 2: 34556371 - 34559685) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000163679 Chr2:34556283..34556370 GTCACTGTCCTTGCGTTCCT Chr2:34556325..34556344 60.31 55
downstream ENSMUSE00000710623 Chr2:34555346..34555426 No primer for this exon
downstream ENSMUSE00000721595 Chr2:34555346..34555426 No primer for this exon
downstream ENSMUSE00000163685 Chr2:34551006..34551128 ATGGCATTCCGGTACTTGTC Chr2:34551034..34551053 59.82 50
downstream ENSMUSE00000694285 Chr2:34551006..34551128 ATGGCATTCCGGTACTTGTC Chr2:34551034..34551053 59.82 50
downstream ENSMUSE00000163693 Chr2:34548893..34549022 TTCCTCACGAGGAGAGTCGT Chr2:34548954..34548973 59.99 55
downstream ENSMUSE00000694284 Chr2:34548893..34549022 TTCCTCACGAGGAGAGTCGT Chr2:34548954..34548973 59.99 55
downstream ENSMUSE00000163690 Chr2:34546626..34546735 GTCTGGCAATCCATTCCTTG Chr2:34546620..34546639 60.46 50
downstream ENSMUSE00000662647 Chr2:34546626..34546735 GTCTGGCAATCCATTCCTTG Chr2:34546620..34546639 60.46 50
downstream ENSMUSE00000163681 Chr2:34545982..34546141 TGCCAGCAACTTCCTACAAG Chr2:34545980..34545999 59.07 50
downstream ENSMUSE00000694283 Chr2:34545982..34546141 TGCCAGCAACTTCCTACAAG Chr2:34545980..34545999 59.07 50
downstream ENSMUSE00000163677 Chr2:34544378..34544565 CTCTTTGTCCCGCAAAACTC Chr2:34544438..34544457 59.85 50
downstream ENSMUSE00000694282 Chr2:34544378..34544565 CTCTTTGTCCCGCAAAACTC Chr2:34544438..34544457 59.85 50
downstream ENSMUSE00000163691 Chr2:34539702..34539915 TCCACCTGAGCCGTTTTATC Chr2:34539848..34539867 60.07 50
downstream ENSMUSE00000694280 Chr2:34539702..34539915 TCCACCTGAGCCGTTTTATC Chr2:34539848..34539867 60.07 50
downstream ENSMUSE00000163692 Chr2:34537155..34537227 AGCTCTGTGGTTTGCAGTCA Chr2:34537148..34537167 59.62 50
downstream ENSMUSE00000694276 Chr2:34537155..34537227 AGCTCTGTGGTTTGCAGTCA Chr2:34537148..34537167 59.62 50
downstream ENSMUSE00000163694 Chr2:34533953..34534150 GGTGCCTCACGGAGATAAAC Chr2:34534109..34534128 59.56 55
downstream ENSMUSE00000694272 Chr2:34533953..34534150 GGTGCCTCACGGAGATAAAC Chr2:34534109..34534128 59.56 55
downstream ENSMUSE00000694316 Chr2:34533003..34533697 CAACTCAGAAAGGCCGAAAG Chr2:34533343..34533362 59.99 50
downstream ENSMUSE00000163683 Chr2:34532505..34533697 CAACTCAGAAAGGCCGAAAG Chr2:34533343..34533362 59.99 50
downstream ENSMUSE00000694269 Chr2:34532505..34533697 CAACTCAGAAAGGCCGAAAG Chr2:34533343..34533362 59.99 50
downstream ENSMUSE00000662646 Chr2:34531704..34533697 CAACTCAGAAAGGCCGAAAG Chr2:34533343..34533362 59.99 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ATCTTCGTCCCCGAGTAAGG Chr2:34559701..34559721 60.46 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCTCCATGCACTCTGTTA Chr2:34559676..34559696 61.21 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000026867