Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29036
Trapped Gene
1190003J15Rik (ENSMUSG00000025481)
Vector Insertion
Chr 7: 148023584 - 148023787
Public Clones CMHD-GT_383A11-3 (cmhd)
Private Clones OST11616 (lexicon)
Severity of mutation (?) Insertion after 76% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000151078 (Chr7:148023585..148023848 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TTAGCCACCCACACAAATCA Chr7:148023727..148023746 59.96 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000151078 (Chr7:148023585..148023848 +)
Downstram Exon
ENSMUSE00000668403 (Chr7:148023585..148023786 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TTAGCCACCCACACAAATCA Chr7:148023727..148023746 59.96 45 TGATTTGTGTGGGTGGCTAA Chr7:148023749..148023768 59.96 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668405 Chr7:148020917..148021157 TGATGACGCTCCAGAGACAC Chr7:148021123..148021142 59.99 55
upstream ENSMUSE00000151077 Chr7:148021178..148021650 ACATGGCTACCGAGAGCAGT Chr7:148021518..148021537 59.9 55
upstream ENSMUSE00000668404 Chr7:148021511..148021650 ACATGGCTACCGAGAGCAGT Chr7:148021518..148021537 59.9 55
upstream ENSMUSE00000151076 Chr7:148022646..148022781 GACACAGAGCGCTACTGGAA Chr7:148022725..148022744 59.19 55

*** Putative Vector Insertion (Chr 7: 148023584 - 148023787) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151078 Chr7:148023585..148023848 TGATTTGTGTGGGTGGCTAA Chr7:148023749..148023768 59.96 45
downstream ENSMUSE00000668403 Chr7:148023585..148023786 TGATTTGTGTGGGTGGCTAA Chr7:148023749..148023768 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAAAGGAGACCCAGAAGTTCC Chr7:148023602..148023623 60.1 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CAAAGGAGACCCAGAAGTTCC Chr7:148023602..148023623 60.1 52.38 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025481