Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29047
Trapped Gene
Hmga2 (ENSMUSG00000056758)
Vector Insertion
Chr 10: 119811757 - 119899719
Public Clones not available
Private Clones OST10931 (lexicon)
Severity of mutation (?) Insertion after 77% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000573669 (Chr10:119899720..119899770 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CCAAGAGGCAGACCTAGGAA Chr10:119899724..119899743 59.42 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000573669 (Chr10:119899720..119899770 -)
Downstram Exon
ENSMUSE00000665541 (Chr10:119811724..119811756 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CCAAGAGGCAGACCTAGGAA Chr10:119899724..119899743 59.42 55 GCAGGCTTCTTCTGAACGAC Chr10:119811706..119811725 60.14 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000639940 Chr10:119913009..119913344 CAGCCTAAGCAGCAGCAGTA Chr10:119913284..119913303 59.54 55
upstream ENSMUSE00000395416 Chr10:119910308..119910394 CCAAAGGCAGCAAAAACAAG Chr10:119910332..119910351 60.77 45
upstream ENSMUSE00000573669 Chr10:119899720..119899770 CCAAGAGGCAGACCTAGGAA Chr10:119899724..119899743 59.42 55

*** Putative Vector Insertion (Chr 10: 119811757 - 119899719) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000665541 Chr10:119811724..119811756 GCAGGCTTCTTCTGAACGAC Chr10:119811706..119811725 60.14 55
downstream ENSMUSE00000665540 Chr10:119800334..119801352 GGTGGGTTCATTGGGTACTG Chr10:119800376..119800395 60.09 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCGTAGGTAATCGCCTTGC Chr10:119830656..119830676 60.23 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GAGGACGTGACTGGGAAAAC Chr10:119863653..119863673 59.56 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000056758