Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29051
Trapped Gene
Ostb (ENSMUSG00000053862)
Vector Insertion
Chr 9: 65260809 - 65261730
Public Clones not available
Private Clones OST10569 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000422553 (Chr9:65261731..65261821 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CAAGCATGTTCCTCCTGAGA Chr9:65261751..65261770 58.96 50 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000422553 (Chr9:65261731..65261821 -)
Downstram Exon
ENSMUSE00000422560 (Chr9:65260521..65260808 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CAAGCATGTTCCTCCTGAGA Chr9:65261751..65261770 58.96 50 TAAGTTAGGCGGCGTTATGG Chr9:65260535..65260554 60.11 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000636032 Chr9:65270554..65270762 TCGGAAGAGTTCCTGTGAGG Chr9:65270623..65270642 60.38 55
upstream ENSMUSE00000422571 Chr9:65262974..65263094 GAGCAGAAACATGGACCACA Chr9:65263055..65263074 59.68 50
upstream ENSMUSE00000422553 Chr9:65261731..65261821 CAAGCATGTTCCTCCTGAGA Chr9:65261751..65261770 58.96 50

*** Putative Vector Insertion (Chr 9: 65260809 - 65261730) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000422560 Chr9:65260521..65260808 TAAGTTAGGCGGCGTTATGG Chr9:65260535..65260554 60.11 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
  No PCR available

Come back to gene ENSMUSG00000053862