Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29063
Trapped Gene
Sesn3 (ENSMUSG00000032009)
Vector Insertion
Chr 9: 14081074 - 14110642
Public Clones IST12030C12 (tigm) IST11654H3 (tigm) IST11943H2 (tigm)
Private Clones OST9921 (lexicon)
Severity of mutation (?) Insertion after 5% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000345422 (Chr9:14080745..14081073 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TACCTGCTCTGCACCAACTG Chr9:14081035..14081054 60.05 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000345422 (Chr9:14080745..14081073 +)
Downstram Exon
ENSMUSE00000215764 (Chr9:14110643..14110708 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TACCTGCTCTGCACCAACTG Chr9:14081035..14081054 60.05 55 GGGTTGAGACACTCGGATTC Chr9:14110672..14110691 59.51 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000345422 Chr9:14080745..14081073 TACCTGCTCTGCACCAACTG Chr9:14081035..14081054 60.05 55

*** Putative Vector Insertion (Chr 9: 14081074 - 14110642) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000215764 Chr9:14110643..14110708 GGGTTGAGACACTCGGATTC Chr9:14110672..14110691 59.51 55
downstream ENSMUSE00000215762 Chr9:14112905..14113102 CTCCGCAAGAAAGATTCCAG Chr9:14113038..14113057 59.95 50
downstream ENSMUSE00000215766 Chr9:14114692..14114874 AGCGATCCCTCCAGTCTTTA Chr9:14114769..14114788 58.89 50
downstream ENSMUSE00000215767 Chr9:14118940..14119176 GGAGGTGTTCTCGATGCTGT Chr9:14119158..14119177 60.27 55
downstream ENSMUSE00000215761 Chr9:14120510..14120684 TCATTTCTTCCCGAGTGGTC Chr9:14120609..14120628 60.05 50
downstream ENSMUSE00000215765 Chr9:14124739..14124857 ATCGAGAGACATCGGCTGTT Chr9:14124783..14124802 59.83 50
downstream ENSMUSE00000215760 Chr9:14125516..14125706 TGTGGTCGTGTCAACATCCT Chr9:14125662..14125681 60.01 50
downstream ENSMUSE00000311241 Chr9:14127007..14127151 TAAACCTTCAGGCTCCGTTC Chr9:14127069..14127088 59.31 50
downstream ENSMUSE00000334896 Chr9:14130064..14130578 AACAAAAACAACCCCGACAG Chr9:14130293..14130312 59.87 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AACATTTGAGAACAAGCCACAA Chr9:14105095..14105117 59.65 36.36 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AACATTTGAGAACAAGCCACAA Chr9:14105095..14105117 59.65 36.36 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000032009