Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29065
Trapped Gene
Gstm2 (ENSMUSG00000040562)
Vector Insertion
Chr 3: 107785057 - 107786853
Public Clones CMHD-GT_470H6-3 (cmhd) CMHD-GT_234C4-3 (cmhd) CMHD-GT_471H3-3 (cmhd) PSTVUpb13f8 (vanderbilt)
Private Clones OST9804 (lexicon)
Severity of mutation (?) Insertion after 84% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000506805 (Chr3:107786854..107786964 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACTTCATGGGTCGCTTTGAG Chr3:107786854..107786873 60.26 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000506805 (Chr3:107786854..107786964 -)
Downstram Exon
ENSMUSE00000385864 (Chr3:107784623..107785056 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACTTCATGGGTCGCTTTGAG Chr3:107786854..107786873 60.26 50 GCACGTGGTAAGAGCTAGGG Chr3:107784878..107784897 59.9 60

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000376948 Chr3:107789276..107789371 TGCTCTGGACACCAGCACTA Chr3:107789311..107789330 60.62 55
upstream ENSMUSE00000670830 Chr3:107789148..107789278 GAGTGAGAACGCTTCTGCTG Chr3:107789254..107789273 58.91 55
upstream ENSMUSE00000495891 Chr3:107788952..107789027 GCCTGCTCCTGGAATACACA Chr3:107788992..107789011 61.21 55
upstream ENSMUSE00000514974 Chr3:107788536..107788600 No primer for this exon
upstream ENSMUSE00000513431 Chr3:107788165..107788246 ACACAAGATCACCCAGAGCA Chr3:107788204..107788223 59.26 50
upstream ENSMUSE00000508853 Chr3:107787967..107788067 AGTTGGCCATGGTTTGCTAC Chr3:107787979..107787998 60 50
upstream ENSMUSE00000174032 Chr3:107787047..107787142 CTCTGAGTTTCTGGGCAAGC Chr3:107787070..107787089 60.13 55
upstream ENSMUSE00000506805 Chr3:107786854..107786964 ACTTCATGGGTCGCTTTGAG Chr3:107786854..107786873 60.26 50

*** Putative Vector Insertion (Chr 3: 107785057 - 107786853) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000636648 Chr3:107784865..107785056 GCACGTGGTAAGAGCTAGGG Chr3:107784878..107784897 59.9 60
downstream ENSMUSE00000385864 Chr3:107784623..107785056 GCACGTGGTAAGAGCTAGGG Chr3:107784878..107784897 59.9 60

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCCTGATCTCACTTCCTC Chr3:107786828..107786848 60.35 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGCCCTGATCTCACTTCCTC Chr3:107786828..107786848 60.35 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040562