Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29075
Trapped Gene
1190003J15Rik (ENSMUSG00000025481)
Vector Insertion
Chr 7: 148021158 - 148021510
Public Clones not available
Private Clones OST9549 (lexicon) OST1125 (lexicon)
Severity of mutation (?) Insertion after 0% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000668405 (Chr7:148020917..148021157 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGATGACGCTCCAGAGACAC Chr7:148021123..148021142 59.99 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000668405 (Chr7:148020917..148021157 +)
Downstram Exon
ENSMUSE00000668404 (Chr7:148021511..148021650 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGATGACGCTCCAGAGACAC Chr7:148021123..148021142 59.99 55 ACTGCTCTCGGTAGCCATGT Chr7:148021540..148021559 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000668405 Chr7:148020917..148021157 TGATGACGCTCCAGAGACAC Chr7:148021123..148021142 59.99 55

*** Putative Vector Insertion (Chr 7: 148021158 - 148021510) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000151077 Chr7:148021178..148021650 ACTGCTCTCGGTAGCCATGT Chr7:148021540..148021559 59.9 55
downstream ENSMUSE00000668404 Chr7:148021511..148021650 ACTGCTCTCGGTAGCCATGT Chr7:148021540..148021559 59.9 55
downstream ENSMUSE00000151076 Chr7:148022646..148022781 TAGCGCTCTGTGTCGAAGAA Chr7:148022741..148022760 59.89 50
downstream ENSMUSE00000151078 Chr7:148023585..148023848 TGATTTGTGTGGGTGGCTAA Chr7:148023749..148023768 59.96 45
downstream ENSMUSE00000668403 Chr7:148023585..148023786 TGATTTGTGTGGGTGGCTAA Chr7:148023749..148023768 59.96 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGATGACGCTCCAGAGACAC Chr7:148021124..148021144 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GTGTCGTGACTGGGAAAACC Chr7:148021205..148021225 60.41 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025481