Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29076
Trapped Gene
Rab25 (ENSMUSG00000008601)
Vector Insertion
Chr 3: 88346293 - 88346622
Public Clones IST10437E6 (tigm) IST10437E6 (tigm)
Private Clones OST9535 (lexicon) OST7921 (lexicon)
Severity of mutation (?) Insertion after 81% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000175608 (Chr3:88346623..88346703 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000175608 (Chr3:88346623..88346703 -)
Downstram Exon
ENSMUSE00000291563 (Chr3:88345958..88346292 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000291599 Chr3:88351955..88352186 No primer for this exon
upstream ENSMUSE00000567123 Chr3:88348983..88349178 No primer for this exon
upstream ENSMUSE00000567122 Chr3:88347242..88347435 No primer for this exon
upstream ENSMUSE00000175608 Chr3:88346623..88346703 No primer for this exon

*** Putative Vector Insertion (Chr 3: 88346293 - 88346622) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000291563 Chr3:88345958..88346292 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCCTTCCAGACTGTCCTCA Chr3:88346624..88346644 59.99 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCCTTCCAGACTGTCCTCA Chr3:88346624..88346644 59.99 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 AACATGTGCTTCCCTTCCTG Chr3:88346706..88346726 60.11 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 AACATGTGCTTCCCTTCCTG Chr3:88346706..88346726 60.11 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000008601