Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29091
Trapped Gene
Actl6a (ENSMUSG00000027671)
Vector Insertion
Chr 3: 32619438 - 32621541
Public Clones not available
Private Clones OST8939 (lexicon)
Severity of mutation (?) Insertion after 80% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000172007 (Chr3:32619357..32619437 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GGGAGTCAGTCACGTTGTCA Chr3:32619380..32619399 59.71 55 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000172007 (Chr3:32619357..32619437 +)
Downstram Exon
ENSMUSE00000171998 (Chr3:32621542..32621637 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GGGAGTCAGTCACGTTGTCA Chr3:32619380..32619399 59.71 55 GCTACGATCACACTGCCGTA Chr3:32621570..32621589 59.9 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000172002 Chr3:32607650..32607802 AGTCACGCCGCTGTTATCTT Chr3:32607717..32607736 59.9 50
upstream ENSMUSE00000171995 Chr3:32610790..32610866 ATGAAGTTGGCGCTCTTGTT Chr3:32610790..32610809 59.88 45
upstream ENSMUSE00000172004 Chr3:32611023..32611197 AGGCCATCTCACCACTCAAG Chr3:32611168..32611187 60.26 55
upstream ENSMUSE00000172013 Chr3:32613439..32613539 CTGTTCTCATGTCGGAAGCA Chr3:32613517..32613536 59.98 50
upstream ENSMUSE00000171999 Chr3:32614338..32614435 ACAGCATCCCTGCATTCTTC Chr3:32614390..32614409 60.23 50
upstream ENSMUSE00000172006 Chr3:32616953..32617047 GTGGAGCTACCCACACCACT Chr3:32616991..32617010 60.03 60
upstream ENSMUSE00000172000 Chr3:32617290..32617396 CATTGTGAAATCCCCTCTGG Chr3:32617291..32617310 60.31 50
upstream ENSMUSE00000171997 Chr3:32617489..32617578 GAAGGTTCTCCAGCCAACTG Chr3:32617501..32617520 59.84 55
upstream ENSMUSE00000171994 Chr3:32618823..32618884 CAAGCTTCCGTTCTTCAGGT Chr3:32618841..32618860 59.47 50
upstream ENSMUSE00000172012 Chr3:32619108..32619222 AGATGCCAACCGTCCACTAC Chr3:32619119..32619138 60 55
upstream ENSMUSE00000172007 Chr3:32619357..32619437 GGGAGTCAGTCACGTTGTCA Chr3:32619380..32619399 59.71 55

*** Putative Vector Insertion (Chr 3: 32619438 - 32621541) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000171998 Chr3:32621542..32621637 GCTACGATCACACTGCCGTA Chr3:32621570..32621589 59.9 55
downstream ENSMUSE00000172011 Chr3:32624169..32624255 CCAATCCATGAGCTGAACCT Chr3:32624236..32624255 60.07 50
downstream ENSMUSE00000477018 Chr3:32625444..32625891 ACACACTGCTTCCCTCCTTC Chr3:32625508..32625527 59.31 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAATGTCCTAATCGCCTTGC Chr3:32619481..32619501 59.19 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGACATCGACATCAGACCAGT Chr3:32619420..32619441 59.12 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027671