Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29099
Trapped Gene
1700028P14Rik (ENSMUSG00000033053)
Vector Insertion
Chr 19: 23667636 - 23691008
Public Clones not available
Private Clones OST8826 (lexicon)
Severity of mutation (?) Insertion after 38% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000249907 (Chr19:23691009..23691114 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TCTGGAGACGGTGAAAAACC Chr19:23691050..23691069 60.09 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000249907 (Chr19:23691009..23691114 -)
Downstram Exon
ENSMUSE00000249857 (Chr19:23667517..23667635 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TCTGGAGACGGTGAAAAACC Chr19:23691050..23691069 60.09 50 AGCAAGCCCGTTTTCTTCTT Chr19:23667531..23667550 60.37 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000249934 Chr19:23727065..23727304 GCGGTGGTATGAGATTGGAC Chr19:23727150..23727169 60.35 55
upstream ENSMUSE00000249907 Chr19:23691009..23691114 TCTGGAGACGGTGAAAAACC Chr19:23691050..23691069 60.09 50

*** Putative Vector Insertion (Chr 19: 23667636 - 23691008) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000249857 Chr19:23667517..23667635 AGCAAGCCCGTTTTCTTCTT Chr19:23667531..23667550 60.37 45
downstream ENSMUSE00000249837 Chr19:23666599..23666667 TCCATAGGAACATCCCGAAA Chr19:23666601..23666620 60.27 45
downstream ENSMUSE00000249814 Chr19:23646975..23647032 No primer for this exon
downstream ENSMUSE00000249783 Chr19:23633250..23633527 CCATGTGTTGATGCCAAGTC Chr19:23633407..23633426 59.97 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 ACATAATCGCCTTGCAGCAC Chr19:23672940..23672960 61.2 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 ACTGGGTTTTCTTGAGTGCAG Chr19:23672961..23672982 59.39 47.62 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033053