Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29100
Trapped Gene
Tmem67 (ENSMUSG00000049488)
Vector Insertion
Chr 4: 11989008 - 11990181
Public Clones not available
Private Clones OST8804 (lexicon)
Severity of mutation (?) Insertion after 90% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000341772 (Chr4:11990182..11990305 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
GACTCGGCGCATTTTCTTAG Chr4:11990261..11990280 59.98 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000341772 (Chr4:11990182..11990305 -)
Downstram Exon
ENSMUSE00000378795 (Chr4:11988902..11989007 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
GACTCGGCGCATTTTCTTAG Chr4:11990261..11990280 59.98 50 TGTTGGGTACAAGGCGTATG Chr4:11988966..11988985 59.46 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000676235 Chr4:12016433..12016575 GATGCACCGTCTCTCTGCTC Chr4:12016521..12016540 61.14 60
upstream ENSMUSE00000391626 Chr4:12014862..12015104 GCGGTCAGATCTCGTTCTTC Chr4:12015032..12015051 59.96 55
upstream ENSMUSE00000676225 Chr4:12014862..12015074 GCGGTCAGATCTCGTTCTTC Chr4:12015032..12015051 59.96 55
upstream ENSMUSE00000676234 Chr4:12014862..12015148 GCGGTCAGATCTCGTTCTTC Chr4:12015032..12015051 59.96 55
upstream ENSMUSE00000397784 Chr4:12013059..12013147 No primer for this exon
upstream ENSMUSE00000393683 Chr4:12007022..12007115 GCTGGGACTGCATTTCTTGT Chr4:12007077..12007096 60.26 50
upstream ENSMUSE00000348722 Chr4:12004483..12004582 AAGCAACTTGCGAGCTTTGT Chr4:12004530..12004549 60.2 45
upstream ENSMUSE00000386476 Chr4:12002770..12002839 CTGCGAACCAACATTTGTGA Chr4:12002811..12002830 60.7 45
upstream ENSMUSE00000421059 Chr4:12002602..12002676 TCCACTGCACGTTATGGAGA Chr4:12002606..12002625 60.26 50
upstream ENSMUSE00000421056 Chr4:12001041..12001103 GTATTTGCAGGCAACAGCAG Chr4:12001052..12001071 59.49 50
upstream ENSMUSE00000421054 Chr4:11997596..11997750 TTGAAAGCACTGCTGGATTG Chr4:11997622..11997641 59.99 45
upstream ENSMUSE00000421052 Chr4:11997384..11997492 CAGGATTGGCTCCTCAAGTT Chr4:11997435..11997454 59.28 50
upstream ENSMUSE00000384965 Chr4:11996561..11996638 CGAGGAAACTTCATCAAATGG Chr4:11996588..11996608 59.56 42.86
upstream ENSMUSE00000340028 Chr4:11996015..11996080 TGGAACAACGTACCAGCAAA Chr4:11996017..11996036 60.15 45
upstream ENSMUSE00000377739 Chr4:11990821..11990977 GAAGAGCAGCACCGTTACCT Chr4:11990880..11990899 59.5 55
upstream ENSMUSE00000341772 Chr4:11990182..11990305 GACTCGGCGCATTTTCTTAG Chr4:11990261..11990280 59.98 50

*** Putative Vector Insertion (Chr 4: 11989008 - 11990181) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000378795 Chr4:11988902..11989007 TGTTGGGTACAAGGCGTATG Chr4:11988966..11988985 59.46 50
downstream ENSMUSE00000676224 Chr4:11987199..11989007 TGTGTTGGGTACAAGGCGTA Chr4:11988964..11988983 60.03 50
downstream ENSMUSE00000332647 Chr4:11985668..11985724 CACAGATGCGTCTCCTTGAT Chr4:11985655..11985674 58.83 50
downstream ENSMUSE00000412289 Chr4:11984463..11984561 CATCCCGCTGTCTTCAAAAG Chr4:11984478..11984497 60.77 50
downstream ENSMUSE00000335506 Chr4:11982178..11982276 AACACATTGGCCAGATCACC Chr4:11982205..11982224 60.79 50
downstream ENSMUSE00000375356 Chr4:11981893..11981979 GCGCACCCCACATAAGTAAC Chr4:11981884..11981903 60.4 55
downstream ENSMUSE00000371097 Chr4:11980822..11980921 GCCGTTCCCAATCAATAAAG Chr4:11980830..11980849 59.41 45
downstream ENSMUSE00000409474 Chr4:11980594..11980733 TTCATTTGCCACGAAATACG Chr4:11980644..11980663 59.56 40
downstream ENSMUSE00000376475 Chr4:11978535..11978675 AGCAGTAGCCACGGCATATC Chr4:11978540..11978559 60.26 55
downstream ENSMUSE00000370542 Chr4:11974957..11975037 CAAACTGCCGGATTTTGTCT Chr4:11974958..11974977 60.11 45
downstream ENSMUSE00000408936 Chr4:11974345..11974461 TGGACTGACCTCCCATGAAT Chr4:11974378..11974397 60.33 50
downstream ENSMUSE00000410948 Chr4:11973150..11973266 CTGCAATCTGAAACGTCTGC Chr4:11973181..11973200 59.6 50
downstream ENSMUSE00000420553 Chr4:11972942..11973046 CAAAAGTACTCCCCGACGAA Chr4:11972979..11972998 60.1 50
downstream ENSMUSE00000420548 Chr4:11970612..11970714 CCATCCCAAGGATTCTTTCA Chr4:11970629..11970648 59.86 45
downstream ENSMUSE00000347937 Chr4:11967782..11967924 GTGGCCTCGTTCCCATAATA Chr4:11967854..11967873 59.78 50
downstream ENSMUSE00000388378 Chr4:11966792..11967039 TGTTTTGGTTGCCAAATTCTT Chr4:11966964..11966984 59.48 33.33

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CGAGTTGCTACCCAGATTTCA Chr4:11990185..11990206 60.26 47.62 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGGTCGTGACTGGGAAAAC Chr4:11990115..11990135 59.04 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000049488