Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2911
Trapped Gene
Ctnnal1 (ENSMUSG00000038816)
Vector Insertion
Chr 4: 56842515 - 56845777
Public Clones AD0552 (sanger) RRM375 (baygenomics)
Private Clones not available
Severity of mutation (?) Insertion after 100% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000368750 (Chr4:56845778..56845864 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CTGGACGAGCTGAGGAGAGA Chr4:56845779..56845798 60.84 60 TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000368750 (Chr4:56845778..56845864 -)
Downstram Exon
ENSMUSE00000327706 (Chr4:56842356..56842514 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CTGGACGAGCTGAGGAGAGA Chr4:56845779..56845798 60.84 60 ACTCAGCCAAAGCTTCCAAA Chr4:56842375..56842394 59.99 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000327764 Chr4:56877849..56878060 GAGCTGTCCACTCCTCCAAC Chr4:56877930..56877949 59.84 60
upstream ENSMUSE00000327758 Chr4:56860682..56860871 CCAACGAAAACTGGGATTTG Chr4:56860725..56860744 60.34 45
upstream ENSMUSE00000327753 Chr4:56857319..56857506 GCTGGCAGATCGTGTAGTCA Chr4:56857348..56857367 60.02 55
upstream ENSMUSE00000327748 Chr4:56854433..56854552 ATTCTCGCAACCATGGAAAG Chr4:56854533..56854552 60.07 45
upstream ENSMUSE00000673892 Chr4:56853768..56853791 CACATGGTGGAAGGAAATGA Chr4:56853768..56853787 59.34 45
upstream ENSMUSE00000327741 Chr4:56851838..56851927 TGTGCTTGAAAAGGGTACGA Chr4:56851861..56851880 59.32 45
upstream ENSMUSE00000360347 Chr4:56850604..56850774 AAGGAGTGTTTGACCGGATG Chr4:56850709..56850728 59.97 50
upstream ENSMUSE00000446507 Chr4:56848050..56848250 TCTTCGGGAGAATGTTTGCT Chr4:56848217..56848236 59.81 45
upstream ENSMUSE00000368750 Chr4:56845778..56845864 CTGGACGAGCTGAGGAGAGA Chr4:56845779..56845798 60.84 60

*** Putative Vector Insertion (Chr 4: 56842515 - 56845777) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000327706 Chr4:56842356..56842514 ACTCAGCCAAAGCTTCCAAA Chr4:56842375..56842394 59.99 45
downstream ENSMUSE00000327698 Chr4:56840124..56840216 TATATGCCGCAACAATCGAC Chr4:56840171..56840190 59.55 45
downstream ENSMUSE00000327689 Chr4:56839146..56839296 TAGACGGATGCAACGTCAAC Chr4:56839235..56839254 59.72 50
downstream ENSMUSE00000327683 Chr4:56835390..56835427 AGTGAAAGATGGTCGCACCT Chr4:56835381..56835400 59.73 50
downstream ENSMUSE00000327672 Chr4:56830119..56830169 GTCAGGTTTGTCGGGCTTTA Chr4:56830103..56830122 60.11 50
downstream ENSMUSE00000327664 Chr4:56829861..56830015 GAGAGCAATCCCAGCTTCAG Chr4:56829947..56829966 60.1 55
downstream ENSMUSE00000327659 Chr4:56829053..56829101 TCCTGGGAAGTTTTCAGTGG Chr4:56829050..56829069 60.08 50
downstream ENSMUSE00000327653 Chr4:56826702..56826758 No primer for this exon
downstream ENSMUSE00000327645 Chr4:56826050..56826163 AAGCTGGTGGCATAGAGGAA Chr4:56826073..56826092 59.84 50
downstream ENSMUSE00000327639 Chr4:56825383..56825466 GGAGCTGGACCACAAGAGTC Chr4:56825390..56825409 59.84 60
downstream ENSMUSE00000327634 Chr4:56823809..56825260 AGAAGAGTCCACAGGCCTCA Chr4:56824776..56824795 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AGCATGTTCCACAGGGAGAG Chr4:56842781..56842801 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGCATGTTCCACAGGGAGAG Chr4:56842781..56842801 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000038816