Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29124
Trapped Gene
4930525F21Rik (ENSMUSG00000027209)
Vector Insertion
Chr 2: 125809502 - 125811991
Public Clones not available
Private Clones OST7917 (lexicon)
Severity of mutation (?) Insertion after 92% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000683991 (Chr2:125811992..125812061 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
AAGGCTTCCAAAAATCTCCAA Chr2:125812031..125812051 60.06 38.1 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000683991 (Chr2:125811992..125812061 -)
Downstram Exon
ENSMUSE00000683990 (Chr2:125809219..125809501 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
AAGGCTTCCAAAAATCTCCAA Chr2:125812031..125812051 60.06 38.1 TTGTGGTGACTGCATCGACT Chr2:125809399..125809418 60.32 50

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000405476 Chr2:125977647..125977720 No primer for this exon
upstream ENSMUSE00000683987 Chr2:125977647..125977740 No primer for this exon
upstream ENSMUSE00000369869 Chr2:125971967..125972007 GGTTCAGTGGATGGAGTTGC Chr2:125971978..125971997 60.52 55
upstream ENSMUSE00000684006 Chr2:125971967..125971987 No primer for this exon
upstream ENSMUSE00000710560 Chr2:125971967..125972007 GGTTCAGTGGATGGAGTTGC Chr2:125971978..125971997 60.52 55
upstream ENSMUSE00000376063 Chr2:125970006..125970059 CCCAAGGAGCTTTGATGAAT Chr2:125970026..125970045 59.13 45
upstream ENSMUSE00000167006 Chr2:125952582..125952813 TGATATCGTCGACAGCTTGG Chr2:125952666..125952685 59.82 50
upstream ENSMUSE00000167005 Chr2:125950740..125950807 CCTGGAACGCTACAAAGCAT Chr2:125950775..125950794 60.27 50
upstream ENSMUSE00000167010 Chr2:125950316..125950351 TCAGATCGAATGGAGACAGAGA Chr2:125950327..125950348 59.95 45.46
upstream ENSMUSE00000167008 Chr2:125949727..125949828 TTACCCAGACATTTGGATGCT Chr2:125949769..125949789 59.44 42.86
upstream ENSMUSE00000167007 Chr2:125946719..125946817 GCATGACTCCTTTTGGTGGT Chr2:125946739..125946758 59.97 50
upstream ENSMUSE00000167009 Chr2:125944730..125944831 No primer for this exon
upstream ENSMUSE00000323637 Chr2:125941739..125941865 CCTTCCAGGAATCATTTCCA Chr2:125941809..125941828 59.86 45
upstream ENSMUSE00000323630 Chr2:125926636..125926770 TCTGCACAACCACCATTCAT Chr2:125926703..125926722 59.97 45
upstream ENSMUSE00000495702 Chr2:125832973..125833070 GCGTACGCAATGCCTAAACT Chr2:125833010..125833029 60.29 50
upstream ENSMUSE00000385303 Chr2:125829625..125829729 AGCTTGGGTCCAGAGTTTCA Chr2:125829695..125829714 59.84 50
upstream ENSMUSE00000641489 Chr2:125829597..125829623 CGTCACTCACAATCCGAAGG Chr2:125829597..125829616 61.65 55
upstream ENSMUSE00000683995 Chr2:125829565..125829729 AATCCGAAGGGAACCAAGTT Chr2:125829587..125829606 59.81 45
upstream ENSMUSE00000559917 Chr2:125829564..125829729 AATCCGAAGGGAACCAAGTT Chr2:125829587..125829606 59.81 45
upstream ENSMUSE00000683983 Chr2:125829524..125829595 ATACTCCGGGAGCCATATCC Chr2:125829560..125829579 60.14 55
upstream ENSMUSE00000683993 Chr2:125814703..125814779 ATCAGGGATGCCAAAAGAAA Chr2:125814733..125814752 59.51 40
upstream ENSMUSE00000721051 Chr2:125814703..125814778 ATCAGGGATGCCAAAAGAAA Chr2:125814733..125814752 59.51 40
upstream ENSMUSE00000683992 Chr2:125813632..125813706 TTCCTGAGAGAGCAACAGGA Chr2:125813656..125813675 58.67 50
upstream ENSMUSE00000683991 Chr2:125811992..125812061 AAGGCTTCCAAAAATCTCCAA Chr2:125812031..125812051 60.06 38.1

*** Putative Vector Insertion (Chr 2: 125809502 - 125811991) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000683990 Chr2:125809219..125809501 TTGTGGTGACTGCATCGACT Chr2:125809399..125809418 60.32 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTCTCCCCTGCTTAATCG Chr2:125811934..125811954 59.41 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGAGAGTTCTCTCCCCTGCT Chr2:125811940..125811960 59.13 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027209