Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29127
Trapped Gene
Alkbh3 (ENSMUSG00000040174)
Vector Insertion
Chr 2: 93836550 - 93841581
Public Clones not available
Private Clones OST7712 (lexicon)
Severity of mutation (?) Insertion after 54% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000387408 (Chr2:93841582..93841670 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
CGCAACCAAGACTTACAGCA Chr2:93841639..93841658 60.05 50 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000387408 (Chr2:93841582..93841670 -)
Downstram Exon
ENSMUSE00000295381 (Chr2:93836340..93836549 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
CGCAACCAAGACTTACAGCA Chr2:93841639..93841658 60.05 50 TTCTCTTCAATGCGGCTCTT Chr2:93836484..93836503 60.1 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000687186 Chr2:93850840..93850964 GGAGTTGGTGCCTCACTCTG Chr2:93850906..93850925 60.86 60
upstream ENSMUSE00000687190 Chr2:93850840..93850887 ACGGCTGATTAGGGTCGTGT Chr2:93850867..93850886 61.86 55
upstream ENSMUSE00000687189 Chr2:93848600..93848749 GCTGGGCTACACCTACCAAG Chr2:93848622..93848641 59.76 60
upstream ENSMUSE00000336216 Chr2:93848581..93848749 GCTGGGCTACACCTACCAAG Chr2:93848622..93848641 59.76 60
upstream ENSMUSE00000391510 Chr2:93848196..93848283 AAGGAACAGCAGCAATGTGA Chr2:93848227..93848246 59.44 45
upstream ENSMUSE00000687188 Chr2:93848196..93848299 AAGGAACAGCAGCAATGTGA Chr2:93848227..93848246 59.44 45
upstream ENSMUSE00000401397 Chr2:93847004..93847038 CCCAGAACCCAGAGTGATTG Chr2:93847005..93847024 60.5 55
upstream ENSMUSE00000384525 Chr2:93844890..93844937 GCCTGTCACCTACTGGTGTG Chr2:93844895..93844914 59.18 60
upstream ENSMUSE00000351013 Chr2:93843210..93843313 GGAAGCTGACTGGATCTTGG Chr2:93843261..93843280 59.8 55
upstream ENSMUSE00000387408 Chr2:93841582..93841670 CGCAACCAAGACTTACAGCA Chr2:93841639..93841658 60.05 50

*** Putative Vector Insertion (Chr 2: 93836550 - 93841581) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000295381 Chr2:93836340..93836549 TTCTCTTCAATGCGGCTCTT Chr2:93836484..93836503 60.1 45
downstream ENSMUSE00000295377 Chr2:93821673..93821771 TGGCTCCTTCCATGATTAGC Chr2:93821668..93821687 60.18 50
downstream ENSMUSE00000352091 Chr2:93820794..93821134 AGAAGCAAACACCACGCTTT Chr2:93820909..93820928 59.92 45
downstream ENSMUSE00000687184 Chr2:93820707..93821134 AGAAGCAAACACCACGCTTT Chr2:93820909..93820928 59.92 45

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGTCACTGCTGTGGCTTTCT Chr2:93841546..93841566 59.62 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TGTCACTGCTGTGGCTTTCT Chr2:93841546..93841566 59.62 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000040174