Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29131
Trapped Gene
Baiap2 (ENSMUSG00000025372)
Vector Insertion
Chr 11: 119864400 - 119867672
Public Clones not available
Private Clones OST7591 (lexicon)
Severity of mutation (?) Insertion after 96% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000669157 (Chr11:119864352..119864399 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ATGTCGAAGTGGCCAGATTT Chr11:119864357..119864376 59.56 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000669157 (Chr11:119864352..119864399 +)
Downstram Exon
ENSMUSE00000421533 (Chr11:119867673..119868093 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ATGTCGAAGTGGCCAGATTT Chr11:119864357..119864376 59.56 45 GGACAGAGTGTCGATGCAGA Chr11:119867773..119867792 59.99 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000661047 Chr11:119804077..119804562 CTCCGAGTCCCTCCTCTAGC Chr11:119804175..119804194 60.49 65
upstream ENSMUSE00000338065 Chr11:119804406..119804562 CAGTTGTCGCTTTCCTCACC Chr11:119804440..119804459 60.83 55
upstream ENSMUSE00000150288 Chr11:119818416..119818491 CATCATGGAGCAGTTCAACC Chr11:119818418..119818437 59.09 50
upstream ENSMUSE00000150262 Chr11:119821471..119821557 AGGCTATTTCGATGCTCTGG Chr11:119821490..119821509 59.43 50
upstream ENSMUSE00000150285 Chr11:119842103..119842164 GGCAGATCCAGAACCAGTTG Chr11:119842136..119842155 60.66 55
upstream ENSMUSE00000150280 Chr11:119842707..119842778 CGCAGCTGGAGCAGAAAGTA Chr11:119842735..119842754 61.77 55
upstream ENSMUSE00000150287 Chr11:119843303..119843440 GAAGAAGCTCCGCAAGAAGA Chr11:119843374..119843393 59.84 50
upstream ENSMUSE00000150274 Chr11:119855010..119855162 CGTGTCTGACGGCTACAAGA Chr11:119855054..119855073 60.05 55
upstream ENSMUSE00000315866 Chr11:119857837..119858061 CAACAGATGGCCAATAGCAA Chr11:119857927..119857946 59.69 45
upstream ENSMUSE00000150270 Chr11:119858203..119858404 GCGACTCGTACTCCAACACA Chr11:119858339..119858358 59.9 55
upstream ENSMUSE00000661046 Chr11:119858323..119858404 GCGACTCGTACTCCAACACA Chr11:119858339..119858358 59.9 55
upstream ENSMUSE00000150272 Chr11:119858803..119859004 GGCACTATGGGGAGAGTGAG Chr11:119858974..119858993 59.68 60
upstream ENSMUSE00000150264 Chr11:119859948..119860016 CTGGACAGTGACGGAAGTGA Chr11:119859982..119860001 59.86 55
upstream ENSMUSE00000150286 Chr11:119860449..119860611 AGCACAGGCAACCTCCTAGA Chr11:119860471..119860490 60.01 55
upstream ENSMUSE00000150282 Chr11:119861866..119861900 No primer for this exon
upstream ENSMUSE00000661045 Chr11:119861866..119863935 TCCTCAGCTCTCGTTGGTTT Chr11:119862477..119862496 59.99 50
upstream ENSMUSE00000645704 Chr11:119862388..119863932 TCCTCAGCTCTCGTTGGTTT Chr11:119862477..119862496 59.99 50
upstream ENSMUSE00000669157 Chr11:119864352..119864399 ATGTCGAAGTGGCCAGATTT Chr11:119864357..119864376 59.56 45
upstream ENSMUSE00000669158 Chr11:119864352..119864379 ATGTCGAAGTGGCCAGATTT Chr11:119864357..119864376 59.56 45

*** Putative Vector Insertion (Chr 11: 119864400 - 119867672) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000421533 Chr11:119867673..119868093 GGACAGAGTGTCGATGCAGA Chr11:119867773..119867792 59.99 55
downstream ENSMUSE00000669156 Chr11:119867673..119868096 GGACAGAGTGTCGATGCAGA Chr11:119867773..119867792 59.99 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TGCCCATCTGTCTGCATCTA Chr11:119864420..119864440 60.38 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TAATGGCTATGCGTGACTGG Chr11:119864440..119864460 59.71 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000025372