Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29133
Trapped Gene
Palmd (ENSMUSG00000033377)
Vector Insertion
Chr 3: 116656056 - 116671415
Public Clones IST14491B3 (tigm)
Private Clones OST7548 (lexicon)
Severity of mutation (?) Insertion after 3% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000717405 (Chr3:116671416..116671776 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
TGCAAAGAGCGGATTTCTCT Chr3:116671563..116671582 60.1 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000717405 (Chr3:116671416..116671776 -)
Downstram Exon
ENSMUSE00000323067 (Chr3:116655975..116656055 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
TGCAAAGAGCGGATTTCTCT Chr3:116671563..116671582 60.1 45 No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000564079 Chr3:116671416..116671870 TGCAAAGAGCGGATTTCTCT Chr3:116671563..116671582 60.1 45
upstream ENSMUSE00000717405 Chr3:116671416..116671776 TGCAAAGAGCGGATTTCTCT Chr3:116671563..116671582 60.1 45

*** Putative Vector Insertion (Chr 3: 116656056 - 116671415) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000323067 Chr3:116655975..116656055 No primer for this exon
downstream ENSMUSE00000323056 Chr3:116650829..116650953 TTCTTTTCCACTGCCGATTC Chr3:116650878..116650897 60.19 45
downstream ENSMUSE00000564073 Chr3:116630493..116630607 CCTCTTCGTTGGCTGAGATT Chr3:116630524..116630543 59.43 50
downstream ENSMUSE00000564071 Chr3:116630319..116630352 CTTCCTTTTCCACCTTCACG Chr3:116630309..116630328 59.71 50
downstream ENSMUSE00000587106 Chr3:116630091..116630201 GTTCGTCATCTGGTCCTTCG Chr3:116630081..116630100 60.66 55
downstream ENSMUSE00000350633 Chr3:116626153..116627253 GATTTCTGCCGGTCCTCATA Chr3:116627099..116627118 60.04 50
downstream ENSMUSE00000717472 Chr3:116624776..116627253 GGGGGAACGTTATTCCAGAT Chr3:116624921..116624940 60.02 50
downstream ENSMUSE00000390849 Chr3:116621181..116621551 CATTTCGTGGCTTCTCCTTC Chr3:116621437..116621456 59.81 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 AAGACTCCAGGCCATCACTG Chr3:116656413..116656433 60.26 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AAGACTCCAGGCCATCACTG Chr3:116656413..116656433 60.26 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 GCCATTCATTTCCCATACCA Chr3:116656774..116656794 60.53 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 TTCACGTGACTGGGAAAACC Chr3:116656710..116656730 60.93 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000033377