Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2914
Trapped Gene
Kpna3 (ENSMUSG00000021929)
Vector Insertion
Chr 14: 62010683 - 62021834
Public Clones AD0533 (sanger) D145C12 (ggtc) D145C12 (ggtc)
Private Clones OST147796 (lexicon)
Severity of mutation (?) Insertion after 11% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000280938 (Chr14:62021835..62021879 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACGATGCGAAGACACAGAAA Chr14:62021860..62021879 59.44 45 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000280938 (Chr14:62021835..62021879 -)
Downstram Exon
ENSMUSE00000122186 (Chr14:62010593..62010682 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACGATGCGAAGACACAGAAA Chr14:62021860..62021879 59.44 45 AGCTTTCTTCTTGGGGAACA Chr14:62010606..62010625 58.91 45

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000280941 Chr14:62058560..62058711 GAGAACCACCGCATCAAGAG Chr14:62058588..62058607 60.8 55
upstream ENSMUSE00000280938 Chr14:62021835..62021879 ACGATGCGAAGACACAGAAA Chr14:62021860..62021879 59.44 45

*** Putative Vector Insertion (Chr 14: 62010683 - 62021834) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000122186 Chr14:62010593..62010682 AGCTTTCTTCTTGGGGAACA Chr14:62010606..62010625 58.91 45
downstream ENSMUSE00000122183 Chr14:62010385..62010414 No primer for this exon
downstream ENSMUSE00000122184 Chr14:62010236..62010288 GCACAGCACTCAACTGGACT Chr14:62010224..62010243 59.05 55
downstream ENSMUSE00000557946 Chr14:62010001..62010096 GGTGGATTTCTGTCACTGGA Chr14:62010045..62010064 58.48 50
downstream ENSMUSE00000557944 Chr14:62006261..62006346 GCAGAAGTTCCCGATGCTAT Chr14:62006265..62006284 59.3 50
downstream ENSMUSE00000122187 Chr14:62003940..62004026 ATGGAGGAGTCGCAGAAAAA Chr14:62003973..62003992 59.81 45
downstream ENSMUSE00000557942 Chr14:62003425..62003594 ATGTGACGTTCCGAAGGAAG Chr14:62003465..62003484 60.11 50
downstream ENSMUSE00000122199 Chr14:62002072..62002116 CACACACAAAGCTGGCAAAA Chr14:62002074..62002093 60.88 45
downstream ENSMUSE00000122188 Chr14:61993121..61993252 AAGTATGACAGCGCCCAAAC Chr14:61993196..61993215 60.14 50
downstream ENSMUSE00000363635 Chr14:61991882..61991923 CTATGTTCCCAACCGCTCTG Chr14:61991871..61991890 60.65 55
downstream ENSMUSE00000406313 Chr14:61991823..61991877 GGAAGTGGGACAGGACATCA Chr14:61991811..61991830 60.93 55
downstream ENSMUSE00000122193 Chr14:61991795..61991923 TCTGCTCATCAGTGCCAGTC Chr14:61991850..61991869 60.15 55
downstream ENSMUSE00000687117 Chr14:61991240..61991247 No primer for this exon
downstream ENSMUSE00000122189 Chr14:61989708..61989812 CTGCTGATTGCCTGCTGTTA Chr14:61989746..61989765 60.16 50
downstream ENSMUSE00000122195 Chr14:61989539..61989610 AGTTGCTAATTGCCCAAGCA Chr14:61989543..61989562 60.77 45
downstream ENSMUSE00000122196 Chr14:61989220..61989382 CATCACCAGCCATTATCAGG Chr14:61989237..61989256 58.95 50
downstream ENSMUSE00000122192 Chr14:61986965..61987059 CATGTTGCTGCAAAACTTCAA Chr14:61987005..61987025 59.9 38.1
downstream ENSMUSE00000387588 Chr14:61984023..61986566 TGCTGTCTTATCGCTTGGTG Chr14:61986375..61986394 60.01 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CAGGTGCTAAGAAGCTGGACT Chr14:62012862..62012883 58.76 52.38 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCGGAAGGTAAGGGGACTAT Chr14:62018820..62018840 59.3 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector
PCR 3 ATAATCGCCTTGCAGCACAT Chr14:62015810..62015830 60.64 45 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 4 GACGATGCGAAGACACAGAA Chr14:62021859..62021879 59.99 50 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000021929