Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29146
Trapped Gene
4933405L10Rik (ENSMUSG00000013158)
Vector Insertion
Chr 8: 108233485 - 108233560
Public Clones not available
Private Clones OST7372 (lexicon)
Severity of mutation (?) Insertion after 53% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000214418 (Chr8:108233300..108233484 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000214418 (Chr8:108233300..108233484 +)
Downstram Exon
ENSMUSE00000214419 (Chr8:108233561..108234144 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000214417 Chr8:108232191..108232415 No primer for this exon
upstream ENSMUSE00000214420 Chr8:108232696..108232913 No primer for this exon
upstream ENSMUSE00000214418 Chr8:108233300..108233484 No primer for this exon

*** Putative Vector Insertion (Chr 8: 108233485 - 108233560) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000214419 Chr8:108233561..108234144 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTGAGGCTAATCGCCTTG Chr8:108233527..108233547 60.48 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 CCCTGGGCTCTTCTCTTGTT Chr8:108233498..108233518 60.76 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000013158