Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI2915
Trapped Gene
Tmem49 (ENSMUSG00000018171)
Vector Insertion
Chr 11: 86457168 - 86474624
Public Clones AD0455 (sanger) AC0592 (sanger)
Private Clones OST413661 (lexicon) OST407099 (lexicon) OST315346 (lexicon) OST7657 (lexicon)
OST6336 (lexicon)
Severity of mutation (?) Insertion after 34% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000105555 (Chr11:86474625..86474735 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000105555 (Chr11:86474625..86474735 -)
Downstram Exon
ENSMUSE00000105549 (Chr11:86457000..86457167 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon No primer for this exon

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000392078 Chr11:86497242..86497323 No primer for this exon
upstream ENSMUSE00000105552 Chr11:86479279..86479380 No primer for this exon
upstream ENSMUSE00000105551 Chr11:86478156..86478291 No primer for this exon
upstream ENSMUSE00000105557 Chr11:86476985..86477075 No primer for this exon
upstream ENSMUSE00000105555 Chr11:86474625..86474735 No primer for this exon

*** Putative Vector Insertion (Chr 11: 86457168 - 86474624) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000105549 Chr11:86457000..86457167 No primer for this exon
downstream ENSMUSE00000105547 Chr11:86448677..86448808 No primer for this exon
downstream ENSMUSE00000105546 Chr11:86424844..86424924 No primer for this exon
downstream ENSMUSE00000105556 Chr11:86420678..86420794 No primer for this exon
downstream ENSMUSE00000105554 Chr11:86415510..86415571 No primer for this exon
downstream ENSMUSE00000105558 Chr11:86399998..86400100 No primer for this exon
downstream ENSMUSE00000363556 Chr11:86398198..86398953 No primer for this exon

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 TTCTGAATAATCGCCTTGCAG Chr11:86474559..86474580 60.35 42.86 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 TTCTGAACGTGACTGGGAAA Chr11:86474560..86474580 59.26 45 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000018171