Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29152
Trapped Gene
Creb3l1 (ENSMUSG00000027230)
Vector Insertion
Chr 2: 91831433 - 91832043
Public Clones not available
Private Clones OST7323 (lexicon)
Severity of mutation (?) Insertion after 48% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000167193 (Chr2:91832044..91832201 -)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
ACCTCGTACAGATGCCTCCA Chr2:91832179..91832198 60.68 55 TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000167193 (Chr2:91832044..91832201 -)
Downstram Exon
ENSMUSE00000167188 (Chr2:91831283..91831432 -)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
ACCTCGTACAGATGCCTCCA Chr2:91832179..91832198 60.68 55 AAGGTCCGCTTCTCCTCTTC Chr2:91831355..91831374 59.96 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000357520 Chr2:91864161..91864327 CTGGACTTGGGAGACCTGAA Chr2:91864186..91864205 60.23 55
upstream ENSMUSE00000167183 Chr2:91842002..91842230 TTGTGCCTGTCAAGATGGAG Chr2:91842015..91842034 59.83 50
upstream ENSMUSE00000167189 Chr2:91835414..91835598 AAACAAGCTGTGCTCCATCA Chr2:91835551..91835570 59.44 45
upstream ENSMUSE00000167186 Chr2:91833428..91833506 TGCCAGTGATCAAAGCAGAG Chr2:91833465..91833484 60.14 50
upstream ENSMUSE00000167193 Chr2:91832044..91832201 ACCTCGTACAGATGCCTCCA Chr2:91832179..91832198 60.68 55

*** Putative Vector Insertion (Chr 2: 91831433 - 91832043) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000167188 Chr2:91831283..91831432 AAGGTCCGCTTCTCCTCTTC Chr2:91831355..91831374 59.96 55
downstream ENSMUSE00000167192 Chr2:91831066..91831124 No primer for this exon
downstream ENSMUSE00000167191 Chr2:91830864..91830932 TGGCAGTCTCTAGGGTTTCC Chr2:91830846..91830865 59.28 55
downstream ENSMUSE00000360669 Chr2:91827193..91827292 GCTGCCATCTTGTACGGTCT Chr2:91827196..91827215 60.28 55
downstream ENSMUSE00000299441 Chr2:91826318..91826444 AGTCATTGAGCCGGAAGAGA Chr2:91826345..91826364 59.95 50
downstream ENSMUSE00000370902 Chr2:91823322..91823589 GTGCCGTTGTCATCAGTGTC Chr2:91823342..91823361 60.17 55
downstream ENSMUSE00000502278 Chr2:91822487..91823164 TAGCAAAGCCCGCACTAACT Chr2:91822623..91822642 60.04 50

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 GCCCCTCACGTAAGCAACTA Chr2:91832031..91832051 60.27 55 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 GCCCCTCACGTAAGCAACTA Chr2:91832031..91832051 60.27 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000027230