Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About

UniTrap UNI29165
Trapped Gene
Tnfrsf1a (ENSMUSG00000030341)
Vector Insertion
Chr 6: 125311139 - 125311316
Public Clones not available
Private Clones OST6924 (lexicon)
Severity of mutation (?) Insertion after 57% of polypeptide chain

Suggested RT-PCR (?)
Control PCR for the trapped allele
Upstream Exon
ENSMUSE00000197619 (Chr6:125311110..125311138 +)
Vector Sequence
Forward Primer Location Tm %GC LacZrt Reverse Primer Location
No primer for this exon TGGCGAAAGGGGGATGTG Gene trap vector
 
 
Control PCR for the wild-type allele
Upstream Exon
ENSMUSE00000197619 (Chr6:125311110..125311138 +)
Downstram Exon
ENSMUSE00000197617 (Chr6:125311317..125311602 +)
Forward Primer Location Tm %GC Reverse Primer Location Tm %GC
No primer for this exon CACTGACAGGTGGCATGAAG Chr6:125311491..125311510 60.31 55

Other possible Exon-Primers for RT-PCR (?)
  Exon ID Exon location Forward Primer Primer location Tm %GC
upstream ENSMUSE00000610106 Chr6:125299791..125299994 GGAGGACCGTACCCTGATCT Chr6:125299866..125299885 60.34 60
upstream ENSMUSE00000399029 Chr6:125299818..125300080 GGAGGACCGTACCCTGATCT Chr6:125299866..125299885 60.34 60
upstream ENSMUSE00000242873 Chr6:125306843..125306996 ATGGGGATACATCCATCAGG Chr6:125306861..125306880 59.44 50
upstream ENSMUSE00000197613 Chr6:125307331..125307459 ACGGCTTCCCAGAATTACCT Chr6:125307405..125307424 59.96 50
upstream ENSMUSE00000197611 Chr6:125307739..125307888 ACCAGTTCCAACGCTACCTG Chr6:125307805..125307824 60.17 55
upstream ENSMUSE00000197620 Chr6:125308072..125308150 GTAACTGCCATGCAGGGTTC Chr6:125308096..125308115 60.53 55
upstream ENSMUSE00000197612 Chr6:125310515..125310591 GCTTGCAAATGTCACAAACC Chr6:125310560..125310579 59.18 45
upstream ENSMUSE00000197618 Chr6:125310728..125310841 AGGCCCGAAGTCTACTCCAT Chr6:125310820..125310839 60.1 55
upstream ENSMUSE00000197619 Chr6:125311110..125311138 No primer for this exon

*** Putative Vector Insertion (Chr 6: 125311139 - 125311316) ***

  Exon ID Exon location Reverse Primer Primer location Tm %GC
downstream ENSMUSE00000197617 Chr6:125311317..125311602 CACTGACAGGTGGCATGAAG Chr6:125311491..125311510 60.31 55
downstream ENSMUSE00000345199 Chr6:125311705..125312493 TTTCACCCACAGGGAGTAGG Chr6:125312095..125312114 59.96 55
downstream ENSMUSE00000344180 Chr6:125311785..125312012 CATCTCCAGCCTCTCGATCT Chr6:125311820..125311839 59.51 55

Suggested Genomic-PCR (?)
  Forward Forward location Tm %GC Reverse name Reverse Reverse Location
PCR 1 CTCCTTCCAACGCCTGATTA Chr6:125311172..125311192 60.21 50 L232 GATGTGCTGCAAGGCGATTA Gene trap vector
PCR 2 AGAAGGGACGACTCCAGCTT Chr6:125311143..125311163 60.39 55 LacZ CCAGGGTTTTCCCAGTCACG Gene trap vector

Come back to gene ENSMUSG00000030341